ID: 1095148983

View in Genome Browser
Species Human (GRCh38)
Location 12:38768236-38768258
Sequence TTGTATATGATTAAGAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 322}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095148983 Original CRISPR TTGTATATGATTAAGAAAGT AGG (reversed) Intronic
902316876 1:15627440-15627462 TTGTATGTGATTAACACAGCTGG - Intronic
903695433 1:25202765-25202787 TTCTATATGATTAATTAATTAGG + Intergenic
905616045 1:39399711-39399733 TTGTAAATGATTAAGAGATCAGG - Intronic
906275016 1:44508901-44508923 TTTTTTATGATGAAGAAACTGGG + Intronic
906433015 1:45771234-45771256 TTTCATATGTTTAAGAAAGTAGG + Intergenic
906443928 1:45876782-45876804 TTGTATAGGTGTAAGGAAGTCGG + Intronic
907179886 1:52560314-52560336 TTTTATCAGATGAAGAAAGTGGG + Intergenic
908306257 1:62821287-62821309 CTGTAAATGATTATGAAGGTAGG + Intronic
908693826 1:66813874-66813896 TAGAATATGATCAAGAGAGTAGG + Exonic
911228774 1:95337472-95337494 TTTTATATAATTAACAAACTTGG - Intergenic
911448767 1:98036428-98036450 TTGTTTATAATTAATAAAATAGG + Intergenic
912063497 1:105704995-105705017 TTCTATAAAAATAAGAAAGTAGG - Intergenic
913031152 1:114904030-114904052 TTGAAAATGAATAATAAAGTTGG - Intronic
913135727 1:115887292-115887314 CTGTAAATGCTTTAGAAAGTTGG - Intergenic
914698265 1:150106075-150106097 TTGTATATGGTTAAGAGATAGGG - Intronic
915015481 1:152729036-152729058 TTTCATATCATTAAGAAAGTAGG + Intergenic
915557793 1:156669931-156669953 TTGCAGATGAGGAAGAAAGTGGG - Exonic
917405216 1:174698574-174698596 CTTTATATGATTAAAAAATTAGG + Intronic
919277827 1:195444401-195444423 TTGTGTTTGATTAAGTAATTGGG - Intergenic
920578437 1:207081472-207081494 ATGTATATGATAAAGTAACTTGG + Intronic
920847869 1:209608666-209608688 TAAAATATGTTTAAGAAAGTTGG - Intronic
921617620 1:217289302-217289324 TTTTATATAATGAAGAAAGGGGG + Intergenic
921776041 1:219101315-219101337 TAGTAGAGGATTAAGAGAGTTGG - Intergenic
923044031 1:230341901-230341923 ATATATATATTTAAGAAAGTAGG + Intronic
923073469 1:230588065-230588087 TTTTATATGATGAAAAAAATGGG + Intergenic
923947745 1:238908055-238908077 TTGTGTATTTTTTAGAAAGTTGG + Intergenic
924520223 1:244799914-244799936 TTGAATATAATTAAGAACTTAGG - Intergenic
1063795798 10:9512844-9512866 TCGTATAGGACTAAGAAAGCAGG + Intergenic
1064885615 10:20108850-20108872 TTGTAGGTGAATAAGAATGTAGG + Intronic
1064969782 10:21053214-21053236 TTGTATATGCTCAAGATGGTAGG - Intronic
1065048707 10:21768098-21768120 TTGTATATTTTTAAGAAATATGG + Intronic
1065666803 10:28071885-28071907 TTGAATATGATAAGGAAAGAAGG + Intronic
1067159597 10:43813159-43813181 TTGTATATGATTGTGAGAGCAGG + Intergenic
1067669832 10:48308524-48308546 TTTAATATGATAAATAAAGTAGG + Intronic
1068425603 10:56859652-56859674 TTGTATATAATGAGGAAAGGAGG + Intergenic
1069178106 10:65320228-65320250 ATGTAAATGAATAAGAAAGGAGG + Intergenic
1069597843 10:69684112-69684134 TTGTATATGTTTAGGAGAGACGG - Intergenic
1070759898 10:79017573-79017595 TTGTATATGACTAAGAATATTGG - Intergenic
1071464859 10:85929817-85929839 TTAAATATGATTAAGAAATATGG - Intronic
1071760178 10:88594432-88594454 TTGTATATGAAAAATAGAGTAGG - Intronic
1072254703 10:93610195-93610217 TTTTATAAGATTATGAAAGATGG + Intergenic
1072845806 10:98829226-98829248 TTTTACAAGATGAAGAAAGTTGG + Intronic
1073740825 10:106404585-106404607 TAGGATATGAGGAAGAAAGTAGG + Intergenic
1074120749 10:110493089-110493111 TTGTTTTTAATTATGAAAGTAGG - Intergenic
1074399757 10:113132374-113132396 TTGTAAATAAATTAGAAAGTTGG + Intronic
1075058993 10:119241556-119241578 TTGTATATAATTGTGAAAATTGG + Intronic
1076400814 10:130183909-130183931 TTGTGTCTGATTCAGAAAGGTGG - Intronic
1076820128 10:132934183-132934205 GTGTATATTTTTAAGAAAATGGG - Intronic
1077849691 11:6063477-6063499 TTGTTTAAGATGAAGAAAGGGGG - Intergenic
1078151490 11:8763141-8763163 TTGTTGATGACTAATAAAGTTGG - Intronic
1078783724 11:14465627-14465649 TTGTAAATGCTTAAGAAACATGG + Intronic
1079227113 11:18616278-18616300 TTCTATATGACTAAGCAAGTGGG + Intronic
1079837686 11:25354718-25354740 TTCTAAATGATGAAGACAGTTGG - Intergenic
1080122757 11:28696317-28696339 TTGTATATTATTAATATAATAGG - Intergenic
1080162908 11:29200398-29200420 TTCTATTTTATTAAGGAAGTAGG + Intergenic
1081176199 11:39930036-39930058 TTGTACATGACTAAAAAAATTGG - Intergenic
1082110548 11:48268903-48268925 GTGTATATGATTACCAAAGTAGG - Intergenic
1083007986 11:59366978-59367000 TTGTATATTAATAAGCAATTTGG - Intergenic
1083117618 11:60478089-60478111 TTGTGTATGTCTAAGAAAGTAGG - Intergenic
1085211104 11:74779501-74779523 TTGCATTTGTTTAAGACAGTCGG + Intronic
1085635327 11:78154846-78154868 TCGTGTTTGATTAATAAAGTAGG + Intergenic
1085970350 11:81582200-81582222 TTCTATGTTTTTAAGAAAGTTGG - Intergenic
1086300910 11:85425601-85425623 TGGTGTACGTTTAAGAAAGTAGG - Intronic
1086637621 11:89108191-89108213 TTCCATATGGTAAAGAAAGTAGG + Intergenic
1087489765 11:98810136-98810158 TTTTATATGATTAAGAATATGGG + Intergenic
1088054494 11:105558618-105558640 TTGAATATAATTATAAAAGTGGG + Intergenic
1090135065 11:124189205-124189227 TTGTTTCTTATTAAGAAAGGAGG - Intergenic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1092473245 12:8796587-8796609 ATGGAAATGATGAAGAAAGTTGG - Intergenic
1092808186 12:12246942-12246964 TTGTTTTTGACTAAGAAAGTTGG - Intronic
1093012523 12:14123996-14124018 TTGTCTATGGTTAAAAAGGTTGG + Intergenic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1093540806 12:20282455-20282477 TTGCAAATGAATAAGAAAGTAGG + Intergenic
1093622277 12:21306222-21306244 GTGTATATGATTATGTAAATAGG - Intronic
1093836882 12:23842988-23843010 TTCTATGTAATTAAGAATGTTGG - Intronic
1095148983 12:38768236-38768258 TTGTATATGATTAAGAAAGTAGG - Intronic
1095610921 12:44127306-44127328 TTGTATTTGATTAAACAACTGGG - Intronic
1095808687 12:46348942-46348964 TAGTATAGGATTCAGAGAGTAGG - Intergenic
1099156908 12:79188904-79188926 TTTTATAAGAATAATAAAGTGGG - Intronic
1101166829 12:102045984-102046006 TTAAGTATGATTAAGAAAGCTGG + Intronic
1106673561 13:31933483-31933505 TTTTATATGCTAAAGAAGGTGGG - Intergenic
1107170495 13:37336802-37336824 TTGTATATGATGAAGTAATGAGG + Intergenic
1107763700 13:43710889-43710911 CTATCTAGGATTAAGAAAGTTGG + Intronic
1108083870 13:46764151-46764173 TTGAATATAACTAAGAAAATGGG + Intergenic
1109188206 13:59294909-59294931 TTTTAAAAGATTAACAAAGTAGG + Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1110856929 13:80306825-80306847 TTGTATATTATTTATAACGTTGG + Intergenic
1111092788 13:83469184-83469206 TTCTATACAATTAAGAAGGTAGG + Intergenic
1112896284 13:104304209-104304231 TGCCATATGAGTAAGAAAGTGGG + Intergenic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1115927764 14:38456037-38456059 TTGTATATGTTTGAGAAAAAGGG - Intergenic
1116006121 14:39293235-39293257 TTATATCTGTTTAATAAAGTTGG + Intronic
1116233990 14:42254437-42254459 TTGTATATTTTAAAGAGAGTAGG + Intergenic
1116298073 14:43137897-43137919 TTGTATATGAGTCAAAAATTAGG - Intergenic
1116674458 14:47887880-47887902 TTCCATATGTTTAAGAAATTTGG + Intergenic
1116816385 14:49587573-49587595 TATTATATGATTAAGGAAGGAGG + Intronic
1118411794 14:65487259-65487281 TTGAATTTTATTAAGAATGTTGG + Intronic
1121757037 14:96411842-96411864 TTCTTTCTGATTAAGAAAGCTGG - Intronic
1123540278 15:21282800-21282822 TAGTAAATGCTAAAGAAAGTGGG + Intergenic
1124434981 15:29640081-29640103 TTGTAAAAGATCAACAAAGTTGG + Intergenic
1124560951 15:30772704-30772726 ATATATGTGATAAAGAAAGTAGG - Intronic
1126497185 15:49304739-49304761 TTGTATATGAGAAAGTAAATTGG - Intronic
1127095236 15:55506173-55506195 TTGTTTATTATTGAGAAAGAGGG - Intronic
1127357966 15:58219468-58219490 TTGTATATGATAAAAAAAATAGG + Intronic
1127813698 15:62587618-62587640 TTGTTTATAATTATGAAAGGAGG - Intronic
1128955455 15:71937795-71937817 TTTTATATAATCAAGAAAATTGG + Intronic
1130539100 15:84809150-84809172 TGGTATCTGAACAAGAAAGTAGG + Intergenic
1131594003 15:93778272-93778294 TTTTATATAATTATGAAAATGGG - Intergenic
1202948590 15_KI270727v1_random:9958-9980 TAGTAAATGCTAAAGAAAGTGGG + Intergenic
1133209811 16:4257254-4257276 TTATATTTTGTTAAGAAAGTGGG - Exonic
1134682349 16:16134995-16135017 TAGTATATGATTAACAACGTGGG + Intronic
1135761803 16:25143962-25143984 TTGTAGGTGATTAGGAAGGTTGG + Intronic
1139809947 16:69606134-69606156 GGCTATATGATCAAGAAAGTTGG + Intronic
1139901972 16:70335321-70335343 TTGTATGTGCTTGAGAAGGTGGG - Intronic
1140762921 16:78127755-78127777 TTGGATATGATCAAAAAAATAGG - Intronic
1142442416 16:90107499-90107521 TTGTGTGTTATTCAGAAAGTCGG + Intergenic
1143694586 17:8602571-8602593 TTGTATTTGATTTTGTAAGTAGG - Intronic
1144364012 17:14524717-14524739 GTTGATATGATTATGAAAGTTGG - Intergenic
1144457316 17:15429893-15429915 TTGTCTATGATCAAGAAAAGAGG + Intergenic
1145107064 17:20126778-20126800 TTAAATATGATGCAGAAAGTTGG + Intronic
1146246475 17:31288239-31288261 TTAAATATGTTTAACAAAGTTGG + Intronic
1146413263 17:32607712-32607734 TTGTAAATGAAGAATAAAGTTGG + Intronic
1146582760 17:34053763-34053785 CTGCATATGATTAAGCAGGTGGG - Intronic
1146785907 17:35721154-35721176 TTGTATTTTATTAAGAAGATAGG + Intronic
1149267294 17:54940711-54940733 TTGCATTTGTGTAAGAAAGTTGG + Intronic
1150351542 17:64448770-64448792 ATGTATCTGCTTAAGACAGTCGG + Intergenic
1150452614 17:65281511-65281533 TGGTGTATCATTAAGAACGTAGG + Intergenic
1150463744 17:65374142-65374164 AGGTATATAATTAAGAGAGTTGG + Intergenic
1150999766 17:70361357-70361379 TTGTGTATAATTAAGAGAATTGG - Intergenic
1155530654 18:26763233-26763255 TTGGATATAGTTTAGAAAGTGGG + Intergenic
1156685844 18:39644622-39644644 TTGAAGAAGATTAATAAAGTGGG - Intergenic
1157832387 18:50868722-50868744 TAGTATATGAGTAAGATTGTCGG - Intergenic
1158144968 18:54301999-54302021 TTTTATTTGTTTAAGAATGTGGG + Intronic
1158450546 18:57560320-57560342 GTGTAAATGATAAAGCAAGTGGG + Intronic
1158828738 18:61254445-61254467 TACTATATGATTAAAAAACTGGG - Intergenic
1159320536 18:66841630-66841652 TGGTTTATGATTAAGCATGTGGG - Intergenic
1160079998 18:75717097-75717119 ATGTAAATGATAAAAAAAGTTGG - Intergenic
1160347137 18:78141474-78141496 TTCTATTTGTTTAAGAAAATAGG - Intergenic
1161668882 19:5593446-5593468 TTGCCTCTGATTTAGAAAGTAGG - Intronic
1164002098 19:21110759-21110781 TTGTATAAGTGTAAGAAAGGGGG + Intronic
1164331499 19:24262803-24262825 TTGTTTTTGATTAAGTAGGTTGG - Intergenic
1164375879 19:27686166-27686188 TTGGTTTTGATTAAGCAAGTTGG - Intergenic
1166216496 19:41339004-41339026 TTGTATTTGATGAAGAAACTGGG + Intronic
1167188807 19:47968061-47968083 TTTTATTTTATTAAGAAAATTGG + Exonic
926930501 2:18034378-18034400 TAGTAAATGATCATGAAAGTTGG - Intronic
927758650 2:25730240-25730262 TTGTAAATGAAGAACAAAGTTGG + Intergenic
928725412 2:34167514-34167536 ATGTATATGTGTGAGAAAGTAGG + Intergenic
929286241 2:40138458-40138480 TGGTATTTGGTTAAGAACGTGGG + Intronic
929633417 2:43490553-43490575 TTGTATCTGCTTAATAATGTGGG + Intronic
930045670 2:47169733-47169755 TTCTATATGCTTATGGAAGTGGG + Intronic
930265904 2:49198845-49198867 GAGTATATAATTAAGTAAGTGGG + Intergenic
931049388 2:58393607-58393629 TTTTGTATGGTTAAGAAAGATGG + Intergenic
931496929 2:62817930-62817952 TTCTATGTGATAAGGAAAGTAGG - Intronic
932116734 2:69057162-69057184 TTGTCTATGAATAAGAGAGCAGG - Intronic
932929599 2:76018406-76018428 CGGTATGTGATTAAGAAAGAAGG + Intergenic
938200493 2:129368594-129368616 TTGTGTATGATTAATACATTTGG - Intergenic
938639195 2:133262704-133262726 CTGTAGATGAATAAGAATGTGGG - Intronic
939188051 2:138883480-138883502 TTGTATATAGCTAAGAAAATGGG - Intergenic
939227385 2:139380982-139381004 TTGTACATGATTATCAAAGATGG + Intergenic
939395811 2:141628299-141628321 TTGTATTGGATTCAGAAAGAAGG + Intronic
939999765 2:148955272-148955294 TTGTATTTGATTAAGTAACTGGG - Intronic
941397487 2:164991339-164991361 TAGTAAATGCTAAAGAAAGTGGG + Intergenic
943267624 2:185755211-185755233 TTATAAATGATTAAGACAGCGGG - Intronic
944421871 2:199539619-199539641 TTGTATTTGTTTGAGAAATTTGG + Intergenic
944454733 2:199881288-199881310 TTGGTAATGATTAAAAAAGTTGG - Intergenic
946221541 2:218231937-218231959 TTGTATATAAATAAATAAGTAGG + Intronic
947199338 2:227600506-227600528 TTGTAAATAAATAAGAAAGTTGG + Intergenic
947606966 2:231492536-231492558 TTGGATATTATAAAGAAATTTGG - Intergenic
1169606268 20:7323079-7323101 CTGTCTATGATCAAGAAAGTTGG - Intergenic
1170997589 20:21378210-21378232 TTGGATATGAGTAATAATGTCGG + Intronic
1171220226 20:23390387-23390409 TTGTATTTCCTAAAGAAAGTAGG - Intronic
1173093444 20:39999815-39999837 TTGTAAAAGAATAACAAAGTTGG + Intergenic
1174883476 20:54306218-54306240 ATTTATATAATTAAGAAGGTTGG + Intergenic
1176912004 21:14577411-14577433 TTTTATAAGATTAAGAAATGGGG - Intronic
1178502633 21:33138425-33138447 TTGAATTTGATTACGAACGTAGG + Intergenic
1179079618 21:38158798-38158820 TTGTATGTGACTAGAAAAGTGGG + Intronic
1181916787 22:26287841-26287863 TTGTGTATGATTAAGGAAAAGGG + Intronic
1182341573 22:29626062-29626084 ATCAATATGATTAAGCAAGTAGG - Intronic
1183000322 22:34851669-34851691 ATGTATATGCTTATGAAACTGGG + Intergenic
1184846209 22:47089095-47089117 TTTTAAATGAGTAAGAGAGTTGG + Intronic
949910600 3:8903288-8903310 TTGTATATATTTAAGAAAGCGGG - Intronic
951056802 3:18156659-18156681 TTGGATTTTATTAAGTAAGTAGG + Intronic
951397534 3:22187965-22187987 TTGCATGTCATTAAGTAAGTGGG + Intronic
952486724 3:33819489-33819511 TTCCATATGTTTAATAAAGTAGG + Intronic
953176274 3:40555691-40555713 TTCTATGTGTTTAAGCAAGTTGG - Intronic
953726515 3:45403889-45403911 ATGTTAAAGATTAAGAAAGTGGG - Intronic
954917271 3:54159179-54159201 TTCAAGATGATTTAGAAAGTGGG + Intronic
955124119 3:56093060-56093082 TTGTAAATGACTAACAAATTAGG + Intronic
955178147 3:56637939-56637961 TTAAATAAGATTAAGAAACTTGG - Intronic
955263501 3:57418838-57418860 TTAAATGTTATTAAGAAAGTTGG + Intronic
955545369 3:60022842-60022864 TTCTATATCATTAAGAATGGGGG - Intronic
956202839 3:66724707-66724729 ATGTATATAATTAAGAAAATAGG + Intergenic
957843132 3:85697055-85697077 ATATATATAATTAAGACAGTAGG - Intronic
958130553 3:89415321-89415343 TTTTTTAAGATTAAGAATGTAGG - Intronic
958812129 3:98872669-98872691 TAGTAAATGATTAAGACAATAGG + Intronic
958812677 3:98879778-98879800 ATGTATATGTTGAAGAAACTAGG + Intronic
959768681 3:110066492-110066514 CTGTATAGTATTAAGCAAGTCGG - Intergenic
960323883 3:116270816-116270838 TTGTATATAATTATTCAAGTGGG - Intronic
960718859 3:120605368-120605390 TAGTATAAGATCCAGAAAGTGGG - Intergenic
961858987 3:129899128-129899150 TTGTATTTGATTAAATAACTGGG + Intergenic
961903915 3:130242634-130242656 TCGTATTTCATTAAGAAAATAGG + Intergenic
962100588 3:132338172-132338194 TTGTATATGCATAAGGAAATTGG - Intronic
962135141 3:132724010-132724032 TTTTTTAGGATTAAGAAATTTGG - Intergenic
962227537 3:133627562-133627584 TTCTATTTGATAAAGAAATTAGG - Intronic
962373719 3:134842193-134842215 CTGTCTATGAATCAGAAAGTGGG + Intronic
962609332 3:137060677-137060699 TTGAGTTTGATTAAGTAAGTGGG + Intergenic
964805834 3:160608639-160608661 TCTTCTATGAATAAGAAAGTGGG + Intergenic
965828781 3:172758763-172758785 TTGCATATGATTAAGGAATCGGG + Intronic
966288589 3:178327269-178327291 TTGTTTATTATTAAGAACTTAGG - Intergenic
967323073 3:188213029-188213051 TTGTATATTTTTTAAAAAGTAGG + Exonic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967935113 3:194721175-194721197 TTGTTTCTGATTAAGAAGTTGGG - Intergenic
968362688 3:198158459-198158481 TTGTGTGTTATTCAGAAAGTCGG + Intergenic
969362274 4:6672519-6672541 GTGTTTATGATTTAGAATGTTGG + Intergenic
970019544 4:11552051-11552073 TTGTTTATCAATCAGAAAGTTGG + Intergenic
970076661 4:12229635-12229657 CTGTCTATGAATAAGAAAGCAGG + Intergenic
970802117 4:19985176-19985198 TTGAAAAAGATGAAGAAAGTGGG - Intergenic
971155676 4:24079543-24079565 TTGTATTAGATTAAAAAAATTGG - Intergenic
971167727 4:24201732-24201754 TTATATATGTTTATGAAGGTAGG - Intergenic
971685363 4:29758914-29758936 TAGTATAAGATAAAGAAACTTGG - Intergenic
971736415 4:30459051-30459073 TTGTAAATGATAAATAAAGTAGG - Intergenic
972526007 4:39912046-39912068 TTTTATCTGGGTAAGAAAGTGGG - Intronic
972600809 4:40570807-40570829 TAGCATATGAGTCAGAAAGTGGG + Intronic
973058830 4:45693721-45693743 TTGGATTTGTTTTAGAAAGTGGG + Intergenic
974422088 4:61689816-61689838 TTTTATAATATTGAGAAAGTTGG - Intronic
974678416 4:65127575-65127597 TAATATATTCTTAAGAAAGTTGG + Intergenic
974715555 4:65666198-65666220 TTTTGTATGTTTAAGAAAGTGGG - Intronic
974813072 4:66970961-66970983 TTTTAAAAGATTAAGAAAATAGG - Intergenic
975154186 4:71052996-71053018 TTATAAATGAACAAGAAAGTAGG - Intergenic
975861060 4:78677447-78677469 TTGTATGTCATTATGAGAGTAGG + Intergenic
976257528 4:83113923-83113945 ATGTATTTTATTAAGATAGTGGG - Intronic
976553288 4:86421548-86421570 TTGTATCTAAAAAAGAAAGTAGG + Intronic
977753141 4:100633553-100633575 TTTTACATCATTAAGCAAGTGGG + Intronic
978834002 4:113125689-113125711 TTATAAATGATTAAGACAGTTGG + Intronic
979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG + Intergenic
981130226 4:141150327-141150349 TTGGATATGAGTATGAAAGAAGG - Intronic
981903899 4:149897069-149897091 TTGTCTATGAGCCAGAAAGTAGG + Intergenic
983165520 4:164471978-164472000 CTCTATAGGATTAAAAAAGTGGG - Intergenic
983176264 4:164591401-164591423 TTATATAGGAACAAGAAAGTTGG + Intergenic
984114546 4:175663498-175663520 TTGAAAATGGTTAAGAGAGTAGG + Intronic
984408752 4:179368705-179368727 TTGTATGTGATTAAAAAAAAAGG + Intergenic
984765365 4:183396741-183396763 TTGTAAATAACTAAGAAGGTGGG - Intergenic
986568312 5:9137820-9137842 TTATATATGATTAATACATTTGG - Intronic
987686283 5:21207586-21207608 TTTTATATGCTTCAGAAAGGTGG - Intergenic
987899782 5:23996893-23996915 TTGTATATAATTAAAAATATCGG + Intronic
987972781 5:24971251-24971273 TTGTCTATCATTAATAAAGTTGG - Intergenic
989275568 5:39584440-39584462 TTGTATATGCTTAGGATAATAGG - Intergenic
989756189 5:44958418-44958440 TTGTAAATGATAAAAAAATTCGG - Intergenic
991197240 5:63949797-63949819 TTTTATATGATTAAAAAATCAGG + Intergenic
991620907 5:68544712-68544734 TTTTATAGGATTAATAAAGCGGG - Intergenic
992089176 5:73302788-73302810 TTTTATATTATCAATAAAGTAGG - Intergenic
992129375 5:73675972-73675994 TAGTATATGATTAATTAAGGAGG + Intronic
993877119 5:93320680-93320702 TTGTACATGATTAAAAAGGATGG - Intergenic
994157172 5:96516692-96516714 ATGTGTATGATTAAGTCAGTTGG + Intergenic
994479407 5:100314650-100314672 TTGTATATGGTTAATAAAAAGGG - Intergenic
994561635 5:101381396-101381418 TTGTATTTGATTAAATAATTGGG - Intergenic
994994364 5:107041039-107041061 TTGTTTATGATTCAGGAAATGGG - Intergenic
995447768 5:112265513-112265535 TTGTATAGGAGTAATATAGTGGG - Intronic
995670486 5:114597469-114597491 TTGTAAAGGATTCAGGAAGTGGG - Intergenic
996875691 5:128238254-128238276 TTGTATATGTTAAAGGATGTGGG + Intergenic
997185434 5:131877198-131877220 TTTTTAATGATTAAAAAAGTAGG + Intronic
998481135 5:142463835-142463857 TTGAAGTTGAATAAGAAAGTAGG + Intergenic
1000242831 5:159424518-159424540 TTGTTTATAATTAAGACAGCAGG + Intergenic
1000516716 5:162244784-162244806 TTGTATATGTACAAGAAAATAGG + Intergenic
1000646151 5:163762677-163762699 TTGAATATGAAGAAGAATGTTGG + Intergenic
1001786416 5:174417855-174417877 TTGTATATGATTATATAGGTGGG - Intergenic
1003485748 6:6577350-6577372 TTGAATATGATTCAGAAGATTGG - Intergenic
1004126840 6:12882285-12882307 TTGGAGATGATTAAGAAATAGGG + Intronic
1004944926 6:20601926-20601948 TTATGTATGATTGAGAAAGGAGG + Intronic
1008182674 6:48352398-48352420 TTCTATAGAATTAAGAAAGTTGG - Intergenic
1008435025 6:51466175-51466197 TTGTGTATTTTTAAGAATGTTGG - Intergenic
1008656895 6:53624425-53624447 ATGTATATGGTGAAGAAACTAGG - Intergenic
1008701089 6:54100973-54100995 TTGTAAAAGATTAATTAAGTGGG - Intronic
1009738132 6:67705804-67705826 TTCTATATGCTAAAGAAAATTGG - Intergenic
1009811995 6:68680072-68680094 TTGTCTATGAACCAGAAAGTTGG + Intronic
1011341502 6:86320248-86320270 TTGAATATGATTGAAACAGTTGG - Intergenic
1012059215 6:94456195-94456217 TTGTCTATCATTAAGAAACACGG - Intergenic
1012831442 6:104208328-104208350 TTGTAGATAATTAAGAAAATTGG + Intergenic
1013914706 6:115321500-115321522 CTGTATATGATTCAGAAAAAGGG - Intergenic
1013988206 6:116222145-116222167 CTGTATATTATTCAGAAAGCAGG - Intronic
1014072432 6:117198557-117198579 TTTTGTATGAGTAAGAAAATAGG - Intergenic
1014488103 6:122025913-122025935 TTGTATTTGTTTAAGGAAATTGG + Intergenic
1015113875 6:129624010-129624032 TTGAATATAATTAAGAAGGTAGG + Intronic
1015863763 6:137707231-137707253 TTCTATAAGATAAAGATAGTAGG + Intergenic
1016120443 6:140337043-140337065 TTGTCTCTGATTAGGGAAGTAGG + Intergenic
1016161135 6:140881023-140881045 TTGTATTTGAGAAAGAATGTGGG - Intergenic
1016633662 6:146261306-146261328 TTGTAAATGAGTAGGAAAGGAGG + Intronic
1019252995 7:30252-30274 TTGTGTGTTATTCAGAAAGTCGG - Intergenic
1019718439 7:2553947-2553969 TTCTTTCTGATTATGAAAGTAGG - Intronic
1019833392 7:3356585-3356607 TTTTATCTGACCAAGAAAGTAGG + Intronic
1020464920 7:8466616-8466638 TAGTATATCATTAAGGAAGATGG + Intronic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1022147860 7:27564597-27564619 TTGAATGTGATTAATAAAGTTGG - Intronic
1023130575 7:36998931-36998953 TTATTTATTATTAAGAATGTGGG + Intronic
1024930312 7:54661934-54661956 TTATATATGATCTAGAGAGTGGG + Intergenic
1025641097 7:63370417-63370439 TAGTGTTTGGTTAAGAAAGTGGG + Intergenic
1028557636 7:92140534-92140556 TTGAAAATGAATAAGAAAGTTGG - Intronic
1028781513 7:94742808-94742830 TTGTCAAAGATAAAGAAAGTTGG - Intergenic
1030735296 7:113041106-113041128 TTATAGATGACTGAGAAAGTGGG - Intergenic
1032517210 7:132515648-132515670 TTGTGTTTGATTCTGAAAGTTGG - Intronic
1037014436 8:13885196-13885218 TTGGATAGTATTAAGAGAGTTGG - Intergenic
1037172853 8:15914219-15914241 TTGAAGATTATTTAGAAAGTTGG + Intergenic
1039643491 8:39251540-39251562 AAGTATATGATTAAAAAAATGGG - Intronic
1039660092 8:39452027-39452049 TTCTATATGACTAAGAACATAGG - Intergenic
1041471159 8:58210565-58210587 TTGTATTTTATTAACAAAGTTGG - Intergenic
1041617639 8:59926739-59926761 TTGTATTTGATTAGGTGAGTTGG - Intergenic
1044844665 8:96368786-96368808 TTGTAAAAGAATAATAAAGTGGG - Intergenic
1045129741 8:99137601-99137623 TTGTTTTTGATGAAGAAAGAAGG + Intronic
1046349097 8:112982790-112982812 TTTTATATTATTCAGAAAGAAGG - Intronic
1046358760 8:113122884-113122906 TTCAAAATAATTAAGAAAGTAGG - Intronic
1046897078 8:119484589-119484611 TTTTATATGAATGAGACAGTTGG - Intergenic
1046964189 8:120145047-120145069 TTGTAGATCAATAAGAAAATGGG + Intronic
1047483513 8:125307329-125307351 TAGTATATGATAAAGAAGATAGG + Intronic
1047586403 8:126278508-126278530 TTTATTATGATTGAGAAAGTAGG + Intergenic
1049775774 8:144403844-144403866 CTTTATTTGATTAAGGAAGTTGG - Intronic
1050772567 9:9220915-9220937 TGGTGTATGAGTAGGAAAGTAGG + Intronic
1051796550 9:20878258-20878280 TTGTACATGATTAAATAATTTGG + Intronic
1052073602 9:24113226-24113248 TCGAATATGCTTAATAAAGTGGG - Intergenic
1052233103 9:26178541-26178563 TTGTATTGGATTAAGTAAGAAGG + Intergenic
1052590514 9:30487702-30487724 TTGTATTTGATTCAGAATCTAGG + Intergenic
1052610381 9:30765232-30765254 TTGTATGGGATGAAGACAGTTGG - Intergenic
1054935570 9:70684016-70684038 TTGTTTAGAATTAAGAAATTAGG + Intronic
1055040930 9:71871365-71871387 TTGTATAGGACACAGAAAGTGGG + Intronic
1055329813 9:75171943-75171965 TTGTTTAAGATATAGAAAGTAGG + Intergenic
1055358071 9:75458429-75458451 TTGTAAATGACTAGGAAAGGAGG + Intergenic
1056185728 9:84132898-84132920 TTCTATGTGTTTGAGAAAGTGGG - Intergenic
1056219278 9:84435456-84435478 TTGTCTATGAGCCAGAAAGTGGG - Intergenic
1057347559 9:94264437-94264459 TTGTATATGTTAAAGAAATTAGG + Intronic
1057667120 9:97054752-97054774 ATTGATAAGATTAAGAAAGTTGG + Intergenic
1058042324 9:100316481-100316503 TTGAATAGGATGATGAAAGTGGG - Intronic
1058823764 9:108756580-108756602 TTGTATATGATTATGAAAACAGG - Intergenic
1059058536 9:111010614-111010636 TTTTATGTCATTAAGAAAGGCGG - Intronic
1061173676 9:128978253-128978275 TTGTATATAAGTATGTAAGTAGG - Intronic
1062219418 9:135406527-135406549 TTGTGTATCATTAATAAAATGGG + Intergenic
1062747375 9:138222122-138222144 TTGTGTGTTATTCAGAAAGTCGG + Intergenic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1187598772 X:20803485-20803507 ATATATATGAATAATAAAGTAGG + Intergenic
1188331938 X:28883745-28883767 TTTTATATGATTAAAAGTGTTGG - Intronic
1188410240 X:29863076-29863098 TTATATATCATTAACAGAGTTGG - Intronic
1189080847 X:37970809-37970831 TTGTATATGCTTATGAAATATGG - Intronic
1189928436 X:45982307-45982329 TTGTTTATGAATATGAAATTTGG - Intergenic
1190605436 X:52137849-52137871 TTGAAAAAGATTAACAAAGTTGG + Intergenic
1190865103 X:54377842-54377864 TTTTATATGGTGAAAAAAGTAGG + Intergenic
1191855432 X:65621547-65621569 TTGAAAAAGATGAAGAAAGTTGG - Intronic
1193616977 X:83700939-83700961 TTGTATATGATTAAGAAAGGAGG + Intergenic
1193677763 X:84477706-84477728 TTGCAAATGATTAAGAAACTTGG - Intronic
1194505418 X:94728450-94728472 GGGTAAATGATTAAGAAAATGGG - Intergenic
1197111215 X:122777414-122777436 GTTGATAGGATTAAGAAAGTTGG + Intergenic
1197195449 X:123695106-123695128 TTATATATGACTAAGAAAGAGGG - Intronic
1197489662 X:127101533-127101555 TTGAATAGGCTTCAGAAAGTGGG + Intergenic
1197573158 X:128175119-128175141 TTGTATATGATGTAAAAAGAGGG - Intergenic
1199841116 X:151650289-151650311 TAGTATATGTTGAAGAAAGCTGG + Intronic
1201777059 Y:17677417-17677439 TTGTTTTTGATTAAGCAGGTTGG - Intergenic
1201824498 Y:18228575-18228597 TTGTTTTTGATTAAGCAGGTTGG + Intergenic
1201885012 Y:18872679-18872701 CTGTCTATGAATGAGAAAGTGGG - Intergenic
1202137294 Y:21679484-21679506 TTTTATGTGATTAAAAGAGTAGG - Intergenic