ID: 1095149743

View in Genome Browser
Species Human (GRCh38)
Location 12:38778311-38778333
Sequence CACCTAAGGAAGCATGTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095149737_1095149743 28 Left 1095149737 12:38778260-38778282 CCATCTAGGTTTGTGTAAGTACA 0: 410
1: 1030
2: 1325
3: 1088
4: 777
Right 1095149743 12:38778311-38778333 CACCTAAGGAAGCATGTCTCGGG 0: 1
1: 0
2: 3
3: 22
4: 131
1095149740_1095149743 4 Left 1095149740 12:38778284-38778306 CCTATGGTGGTTTCACAACAATG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1095149743 12:38778311-38778333 CACCTAAGGAAGCATGTCTCGGG 0: 1
1: 0
2: 3
3: 22
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095149743 Original CRISPR CACCTAAGGAAGCATGTCTC GGG Intronic
901093162 1:6657049-6657071 CTCCTAAGGAACCATGCCTGCGG + Intronic
909048480 1:70739148-70739170 CAGTTAATGAAGCATGACTCTGG - Intergenic
910858757 1:91722645-91722667 CACCTAATGATGCATTTCTCAGG - Intronic
911090932 1:94016341-94016363 CCCCTGAGGAAGCCCGTCTCTGG - Intronic
911542972 1:99181199-99181221 GACGAAAGGAAGCATGTATCTGG - Intergenic
912565868 1:110586891-110586913 CACATAAGGAAGCATGGACCAGG + Intergenic
912577401 1:110686072-110686094 CAGCTGAGGCAGGATGTCTCAGG - Intergenic
913068341 1:115277895-115277917 CACCTAAGGCTGCATATCTGTGG + Intergenic
913609521 1:120496470-120496492 CCCCTAAGGAAACAGGGCTCTGG - Intergenic
914204299 1:145514046-145514068 CACCCAAGGAAACAGGGCTCTGG + Intergenic
914483422 1:148087234-148087256 CCCCTAAGGAAACAGGGCTCTGG + Intergenic
914581670 1:149025374-149025396 CCCCTAAGGAAACAGGGCTCTGG + Intronic
919757758 1:201076455-201076477 CACCCAAGGGAGCATGGCTGTGG - Intronic
922145166 1:222936270-222936292 CACCCGATGATGCATGTCTCTGG + Intronic
923032138 1:230257635-230257657 CGCCTAAGGATGCATTTTTCAGG + Intronic
924246892 1:242093958-242093980 CATCTCAGGAATCATGGCTCTGG + Intronic
924613335 1:245591672-245591694 CACCTGAGAACGCCTGTCTCTGG + Intronic
1065176759 10:23084174-23084196 CACCTAATGATGCATTTCTCAGG + Intergenic
1065502972 10:26399968-26399990 CACTTGTGGAAGCGTGTCTCAGG - Intergenic
1067671463 10:48326364-48326386 CACCGATGGAAGTATGTCACAGG - Intronic
1070625505 10:78048156-78048178 CACTTAAGGAAGCATTTCCAGGG + Intronic
1076353499 10:129834798-129834820 AACCAAAAGAAGCATGTGTCTGG + Intergenic
1080872456 11:36248883-36248905 CTTCTAAGGAAGTTTGTCTCAGG + Intergenic
1081822546 11:46013605-46013627 GACCTAAGGATGCATTTCTCAGG - Intronic
1084541653 11:69790724-69790746 CACCTTGGGAAGCCAGTCTCTGG + Intergenic
1089781236 11:120874637-120874659 CACCAGAGGAAGCATGGCTGGGG - Intronic
1093203466 12:16218437-16218459 CACCTAATGACACATTTCTCTGG - Intronic
1093885429 12:24454291-24454313 CACTTAAGCAAGCAACTCTCAGG + Intergenic
1095149743 12:38778311-38778333 CACCTAAGGAAGCATGTCTCGGG + Intronic
1096459789 12:51815680-51815702 CCCCCAAGGAAGCTTGGCTCTGG + Intergenic
1096897915 12:54843143-54843165 CACCTAATGATGTATTTCTCAGG + Intronic
1101725263 12:107383381-107383403 CACCCCAGGCAGCCTGTCTCTGG - Intronic
1106061709 13:26299310-26299332 CACCTAACAATGCATTTCTCAGG - Intronic
1108747116 13:53407165-53407187 CACCTAATGATGCATTTTTCAGG - Intergenic
1109591976 13:64496537-64496559 CACCTAAGGATGCATTTCTCAGG + Intergenic
1110379114 13:74829249-74829271 TACATAAGAAAACATGTCTCAGG - Intergenic
1113137101 13:107103586-107103608 CACCTAACAATGTATGTCTCAGG + Intergenic
1114975846 14:28098394-28098416 CGCCTAATGATGCATTTCTCAGG + Intergenic
1116351494 14:43869492-43869514 CACCTAAGAAGTCATGTCTTGGG - Intergenic
1116477806 14:45361955-45361977 CACCTAAGAATGCATTTCTCAGG - Intergenic
1117081393 14:52155839-52155861 CAGCTAGGGCAGCATATCTCGGG - Intergenic
1117994212 14:61463282-61463304 CACCAAAGGAAAAATGTCCCAGG + Intronic
1122106120 14:99456644-99456666 CATCTAAGGAAGCTTATTTCAGG + Intronic
1122615216 14:103012999-103013021 CACCTAACCATGCATTTCTCAGG + Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128252676 15:66173973-66173995 GACATATGGGAGCATGTCTCAGG - Intronic
1130459480 15:84150617-84150639 CCACTCAGGAAGCATGTGTCAGG + Intergenic
1130920987 15:88344356-88344378 CACCTGAGGAGGCATGCTTCAGG + Intergenic
1131632548 15:94194619-94194641 CGCCTAAGGAAGGCTGTCTTAGG + Intergenic
1137722497 16:50635672-50635694 CAGCTCAGGAAGCATGTCTAAGG + Exonic
1137956044 16:52830818-52830840 CAAATAAGGAAGCAAGTCTAGGG + Intergenic
1140928905 16:79609174-79609196 TGCCTGAGGAAGCATGGCTCTGG + Intergenic
1142316596 16:89351022-89351044 CACCTAACAACGCATTTCTCAGG + Intronic
1152115772 17:78386132-78386154 CACCCCAGGAAGCCTGACTCAGG - Intronic
1153624069 18:7006580-7006602 CAGCTAGGGATGCATTTCTCAGG - Intronic
1153782437 18:8506100-8506122 CACCTAACAATGCATTTCTCAGG - Intergenic
1155649086 18:28118695-28118717 CACCTAAGGAAGGAAGACTTAGG + Intronic
1159573532 18:70147484-70147506 CACCTAACAAAGCATTTCTCAGG + Intronic
1161099389 19:2413852-2413874 CACCAAAGCCAGCATGCCTCTGG + Exonic
1164465433 19:28483670-28483692 CACCTAAGGAGGGGTGTCCCTGG - Intergenic
1165169136 19:33879052-33879074 CAACTAAGAAAACATTTCTCAGG - Intergenic
925311353 2:2885916-2885938 CACCTAATGATACATTTCTCAGG - Intergenic
926844430 2:17120007-17120029 CACCTAAGGCAATATGTCCCAGG - Intergenic
927927242 2:27022457-27022479 CGCCTAAGGATGCATTTCTCTGG - Intronic
928479449 2:31667244-31667266 CACCAAAGGAAGCAGGTTTAGGG - Intergenic
932809817 2:74815551-74815573 CACCTAATGACGCATTTCTCAGG - Intergenic
935501225 2:103842191-103842213 CACCTAAGGTAACATGTCTGGGG - Intergenic
935890814 2:107675904-107675926 CACCTTTGTAAGCATTTCTCTGG + Intergenic
937086754 2:119177061-119177083 CACCTGAGCCAGCATGTGTCAGG - Intergenic
937165819 2:119816035-119816057 CACCTAACGACACATTTCTCAGG - Intronic
939511451 2:143110808-143110830 AACCACAGGAAGCATGACTCAGG + Intronic
939520056 2:143218696-143218718 CACCTAAGGATGCATCTCTCAGG - Intronic
940910480 2:159205705-159205727 CACCTAACGACTCATTTCTCAGG + Intronic
947165435 2:227256869-227256891 CACCTAATGATGCATTTCTCAGG - Intronic
947314596 2:228842128-228842150 CACCTAAGGACACATTTCTGGGG - Intergenic
948596005 2:239079660-239079682 CACCTGAGTATGCACGTCTCCGG - Intronic
949024967 2:241763185-241763207 CACCTAATGACACATTTCTCAGG - Intronic
1171315311 20:24185857-24185879 GATCCAAGGAGGCATGTCTCAGG - Intergenic
1171455515 20:25269839-25269861 CCCAAAAGGAAGCAGGTCTCGGG - Intronic
1172492780 20:35354157-35354179 TACCTAATGATGCATTTCTCAGG + Intronic
1178605041 21:34028827-34028849 CACCTAACAATGCATTTCTCAGG - Intergenic
1178928508 21:36795680-36795702 TCCCTAAGGCAGGATGTCTCAGG - Intronic
1182963895 22:34503868-34503890 CACCTAGGGATGCATGTCTGAGG + Intergenic
1183524238 22:38314385-38314407 CAGCCAAGCAAGCATGTCTTTGG + Intronic
949698339 3:6726099-6726121 CACAAAAGCAAGCATTTCTCAGG - Intergenic
950246536 3:11424759-11424781 CATCTATGGAAGAATATCTCTGG - Intronic
950913838 3:16622896-16622918 TACCAAAGAAAGAATGTCTCAGG - Intronic
950977344 3:17262106-17262128 CACCTAATGACACATTTCTCAGG - Intronic
951724594 3:25743162-25743184 CTCCAAAAGAAGCATGGCTCTGG + Intronic
953360390 3:42290639-42290661 CATCTAAGGAAGAATATTTCTGG + Intergenic
955658144 3:61266390-61266412 CACATAAGGACACATTTCTCAGG - Intergenic
955931287 3:64059629-64059651 CCCCTGAGGATGCTTGTCTCAGG - Intergenic
961915844 3:130374167-130374189 CACCTAATGATGCATTTCTCAGG - Intronic
965868091 3:173230463-173230485 CACCTAATGACACATTTCTCAGG - Intergenic
969289788 4:6231176-6231198 CACCGGAGGAAGCATGCATCAGG + Intergenic
970839138 4:20446175-20446197 CACTTAAGGCAGTTTGTCTCTGG + Intronic
971253068 4:24989327-24989349 CTCACAGGGAAGCATGTCTCTGG - Intergenic
975706268 4:77114970-77114992 CACTTAATGATGCATTTCTCAGG - Intergenic
976151308 4:82095133-82095155 CACCTAGGAAAGCAGGCCTCGGG - Intergenic
977227495 4:94410684-94410706 CACCCAAGAAAGCGTGTATCAGG - Intergenic
980851330 4:138386795-138386817 AACTTAATGAAGCACGTCTCAGG + Intergenic
981538394 4:145823996-145824018 CACTGAAGGAAACATGTCACTGG + Intronic
982027715 4:151268031-151268053 CACCTAATGACACATTTCTCAGG - Intronic
984855439 4:184191133-184191155 CTTCTAAGGAAGCAGCTCTCAGG - Intronic
985257576 4:188085227-188085249 CGCCTAAGGATGCATTTCTCAGG - Intergenic
985865949 5:2514687-2514709 CACCTGAGCATGCATTTCTCAGG - Intergenic
986173788 5:5334685-5334707 CACCCAGGGGAGCTTGTCTCAGG - Intergenic
1001850183 5:174956956-174956978 CACCTATGTCAGCATGACTCTGG + Intergenic
1001891957 5:175347025-175347047 TTCCTAAGGAATCATGTCTCTGG + Intergenic
1002032467 5:176440553-176440575 CACTGAAGGATGCATCTCTCTGG - Intergenic
1002871961 6:1174907-1174929 CACCTAACGACACATATCTCAGG + Intergenic
1003186183 6:3832689-3832711 CACCCAAAGAAGTGTGTCTCCGG - Intergenic
1003547484 6:7072311-7072333 CACCTAATGATGCATTCCTCAGG - Intergenic
1003815799 6:9838773-9838795 CACCACAGGAGGCATGGCTCAGG - Intronic
1006335286 6:33417372-33417394 CAGCTCTGGAAGCCTGTCTCTGG - Intronic
1006598629 6:35211717-35211739 CACCTAAGCCACTATGTCTCTGG - Intergenic
1007121768 6:39388146-39388168 GACTTGAGGAAGCATGTGTCAGG - Intronic
1010505119 6:76647651-76647673 CACCTAATGAAACTTTTCTCTGG - Intergenic
1012055169 6:94397490-94397512 TGCCTAAGAAAGCATTTCTCAGG + Intergenic
1012397506 6:98816440-98816462 CATCTAATGATGCATTTCTCAGG - Intergenic
1014574947 6:123058420-123058442 CACATGAGGAATCATGCCTCAGG - Intronic
1022555691 7:31293466-31293488 CACCTAATGATGCATTTCTCAGG + Intergenic
1023068178 7:36400743-36400765 CACCCAAGGAAGCATTCCTTAGG + Intronic
1023447982 7:40251650-40251672 CCCTTAAGGAAGAAAGTCTCAGG - Intronic
1024386137 7:48754051-48754073 CACTACAGGAAGCATGCCTCCGG + Intergenic
1024688355 7:51772809-51772831 CACAGAAGGCAGCATGTCTGTGG - Intergenic
1032198356 7:129802413-129802435 CACCTAAGCATGCACTTCTCAGG + Intergenic
1032544666 7:132731658-132731680 CAGCTAAGGAAACATGTCTAGGG + Intergenic
1033594154 7:142842784-142842806 CACCTGAGGAAGCACACCTCAGG + Intergenic
1035066484 7:156108907-156108929 CACCTAACGACGCATTTCTCAGG - Intergenic
1035916911 8:3634799-3634821 CGCCTAAGGAAGCATTTCTCAGG - Intronic
1036485144 8:9172732-9172754 CTCCAAAGGAAGCTCGTCTCTGG - Intergenic
1039734499 8:40316115-40316137 CACCTGTGGAAGGAAGTCTCTGG + Intergenic
1040835700 8:51729112-51729134 CACCTAATGATGCATTTCTCAGG + Intronic
1045093380 8:98770583-98770605 CACCAAAGGAAGCATATCAAAGG + Intronic
1046410871 8:113841131-113841153 CACCTAACTATGCATTTCTCAGG - Intergenic
1047822270 8:128534347-128534369 CACCTAATGATGCATTTCTCAGG + Intergenic
1048565317 8:135590036-135590058 CGCCTAATGATGCATTTCTCAGG - Intronic
1051915902 9:22207440-22207462 CACCAAAGGGAGCAGTTCTCCGG - Intergenic
1052016987 9:23480439-23480461 CACCTAAGTAAGTATATATCCGG - Intergenic
1052172141 9:25412797-25412819 TCCCTAAGGAAGCCTGTCTCTGG + Intergenic
1054893871 9:70285178-70285200 CTCCTAGGAAATCATGTCTCCGG - Intronic
1056961472 9:91128133-91128155 CACCTAATGATGCATTTCTTAGG + Intergenic
1058216505 9:102240268-102240290 CACCTAAGAAATCATGTTTTTGG + Intergenic
1058260635 9:102825666-102825688 CACCTAAGGTAGCATTGCTCAGG - Intergenic
1059902697 9:118945771-118945793 CCACTAAGGAGACATGTCTCTGG + Intergenic
1060196148 9:121624756-121624778 CGCCTAATGATGCATTTCTCAGG + Intronic
1060776930 9:126381518-126381540 CAGCAAAGGCAGCATGGCTCAGG + Intronic
1062335916 9:136067454-136067476 CACCTAATGATGCATTTCTCAGG - Intronic
1186236510 X:7516641-7516663 CAGCCAAGGATGCATTTCTCAGG - Intergenic
1186294759 X:8136837-8136859 AACCTAAAGATGCATTTCTCAGG + Intergenic
1188368938 X:29345157-29345179 CACATAAGCAAGTATTTCTCTGG + Intronic
1188623020 X:32249853-32249875 CAGCCAAGGAAGCATCTCTGAGG - Intronic
1193847360 X:86490595-86490617 CTCAAAGGGAAGCATGTCTCTGG - Intronic
1194346718 X:92773989-92774011 CAGCAAAGGCAGCATGGCTCTGG - Intergenic
1195330764 X:103797416-103797438 CACCTAAGGCTGTGTGTCTCTGG - Intergenic
1200655051 Y:5890633-5890655 CAGCAAAGGCAGCATGGCTCTGG - Intergenic