ID: 1095153598

View in Genome Browser
Species Human (GRCh38)
Location 12:38825088-38825110
Sequence ATTCACACTGGGGAAATAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095153598_1095153603 -7 Left 1095153598 12:38825088-38825110 CCTATTATTTCCCCAGTGTGAAT 0: 1
1: 0
2: 1
3: 14
4: 180
Right 1095153603 12:38825104-38825126 TGTGAATTTCTCGGCTATTTCGG 0: 1
1: 0
2: 0
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095153598 Original CRISPR ATTCACACTGGGGAAATAAT AGG (reversed) Intronic
902669037 1:17959458-17959480 TTTCACACTTGGGAAAATATTGG - Intergenic
902822150 1:18949996-18950018 ATTCTCACTGGGGACAAATTTGG - Intronic
905316682 1:37086312-37086334 ATTGACACTGGGGAGAAAAGAGG - Intergenic
907698064 1:56754120-56754142 ATTGACACTGTGGCATTAATTGG - Intronic
908055418 1:60280946-60280968 ATTCACCCTGGGTGAATACTGGG + Intergenic
909762977 1:79316324-79316346 ATCCACACTAGAGAAATAAATGG - Intergenic
910200970 1:84698232-84698254 ATTCACATTTGGATAATAATGGG + Intergenic
911455759 1:98121260-98121282 CTTCAGACTTGGGAAAGAATAGG - Intergenic
911523566 1:98958316-98958338 ATTCACACTGGGGTAAAAGTAGG - Intronic
912079200 1:105913841-105913863 CTTCAGAGTGGGGAAATGATAGG + Intergenic
915252004 1:154597219-154597241 ACTCACACTGGGGAAAGTTTGGG + Exonic
915975011 1:160379674-160379696 TTTTATCCTGGGGAAATAATGGG - Intergenic
916148899 1:161766677-161766699 ATTCCCACTGGGGAAGTACCGGG + Intronic
916299774 1:163261154-163261176 ATTCAAACTGGGGAAAGAAGAGG - Intronic
918626170 1:186658222-186658244 ATACTCTCTGGGAAAATAATAGG - Intergenic
920286353 1:204882512-204882534 ATACACAGTGGGGAAAGAAAGGG - Intronic
921948074 1:220901878-220901900 ATTCACAGTGGGGAAAGAAGAGG - Intergenic
924414151 1:243840870-243840892 TTTCACAATGGGGAGATATTAGG + Intronic
1063235224 10:4107304-4107326 ATTCACATTTGGGAAATTGTAGG - Intergenic
1063891861 10:10638395-10638417 ATGAACAGTGGGGAAATAAATGG + Intergenic
1067968199 10:50938618-50938640 ATTTAATCTGAGGAAATAATTGG - Intergenic
1069244703 10:66189449-66189471 AGACACAATGGGGAAATAAATGG - Intronic
1071767361 10:88682794-88682816 ATCCTCACTTGGAAAATAATAGG - Intergenic
1077003203 11:335715-335737 ATTCACACTGGGGAGAAAATGGG - Intergenic
1077267496 11:1658990-1659012 ATTCTTACTGGGTAAACAATAGG - Intergenic
1077564111 11:3285519-3285541 ATGCAAACTGGCTAAATAATTGG + Intergenic
1077570001 11:3331336-3331358 ATGCAAACTGGCTAAATAATTGG + Intergenic
1078245793 11:9573014-9573036 ACCCACCCCGGGGAAATAATGGG + Intergenic
1079756376 11:24269197-24269219 ATTCAGACTTGGGATATGATTGG - Intergenic
1080148778 11:29023358-29023380 ATTCACACTAGGGAAAGCAATGG - Intergenic
1081287864 11:41294175-41294197 ATTCTCTTTGGGGAAATAAATGG - Intronic
1081463386 11:43292712-43292734 ATTCAGACAGGGAAAAAAATTGG + Intergenic
1081532982 11:43976944-43976966 AGTAAGACTGGGTAAATAATCGG + Intergenic
1082627608 11:55503194-55503216 ATTCACACTGGGGAAGCATGAGG - Intergenic
1085908546 11:80794058-80794080 ATTCGCACTGGGAAAATACAGGG + Intergenic
1085911172 11:80828686-80828708 ATTCACATTGGGGAAAGACATGG + Intergenic
1085996508 11:81922089-81922111 ACTCATAATGTGGAAATAATTGG - Intergenic
1086782999 11:90930585-90930607 CTTCAGAGTGGGGAAATAATAGG + Intergenic
1087179867 11:95131289-95131311 CTTCACACTGCTGAAATAAAGGG - Exonic
1087423764 11:97965164-97965186 CTTCATACTGGGGAACTAACAGG + Intergenic
1087500548 11:98946884-98946906 ATCCATACTTGGTAAATAATTGG + Intergenic
1090422113 11:126582532-126582554 ATTCAGACTGGGGAGGTAAATGG - Intronic
1094121987 12:26984816-26984838 ATTCACTCTGGGGGAATGAAAGG + Intronic
1095153598 12:38825088-38825110 ATTCACACTGGGGAAATAATAGG - Intronic
1095217001 12:39560690-39560712 ATTCAAAATGGGGAGATAAAGGG + Intronic
1096721003 12:53521774-53521796 TTTCATGCTGGGGATATAATAGG - Intronic
1098203429 12:68081471-68081493 ATACAAACTTGGTAAATAATTGG - Intergenic
1099165257 12:79298489-79298511 ATTTACACTGATAAAATAATAGG + Intronic
1100780641 12:98022442-98022464 ATTCACACTGTGTAAAGGATTGG - Intergenic
1101411123 12:104469410-104469432 AGTGACACTTGGGAAATAACAGG + Intronic
1104533258 12:129593112-129593134 AATCACTCTGGGGAAAAAAAAGG + Intronic
1106731551 13:32546334-32546356 ATTCTCACTGGTGAAATTAAAGG + Intergenic
1107388196 13:39935902-39935924 AATAACAATGGGGTAATAATAGG + Intergenic
1109674062 13:65650257-65650279 CTACACATTGGGGAAATAATAGG - Intergenic
1112651095 13:101399568-101399590 ATTAACACTGGGGAAACCATGGG - Intronic
1114711890 14:24787037-24787059 AGTCACACTGGTGAATTAAATGG - Intergenic
1114733354 14:25018147-25018169 ATGCACACTGGAGGAAGAATGGG - Intronic
1114938983 14:27581880-27581902 ATTCACAATGGCAAAATCATGGG + Intergenic
1115369773 14:32599996-32600018 ATTAATACTGGGGTAAGAATTGG - Intronic
1118395199 14:65330247-65330269 ATTCACCCTGGGAAGATGATAGG + Intergenic
1118685033 14:68282743-68282765 ATTCACTCTGGAGATAGAATTGG + Intronic
1125472967 15:40022411-40022433 ATTCACATTGAGAATATAATTGG + Intronic
1125732986 15:41904494-41904516 ATACACACTGGGGAACTTAAAGG + Intronic
1127290607 15:57567354-57567376 ATTTATACTAGGGAAATATTAGG - Intergenic
1129537295 15:76324078-76324100 ATTCACACTTGGGAAAGTAGGGG + Intergenic
1131858701 15:96627832-96627854 ATTCAAGCTGGGCAAATAAGGGG + Intergenic
1133640905 16:7716516-7716538 AGGTAGACTGGGGAAATAATAGG - Intergenic
1135514043 16:23114430-23114452 ACTCCCAATGGGGAAAAAATAGG + Intronic
1137848643 16:51716023-51716045 AACCACACTGGGCACATAATAGG - Intergenic
1138368175 16:56500692-56500714 TTTCAAACTGAGGAAATAAAAGG + Intronic
1139202859 16:64996841-64996863 ATTCCCACTGGGTAAACATTGGG - Intronic
1143000951 17:3794737-3794759 AGTCACTCTGGGGAAAAAACAGG + Intronic
1147514257 17:41101523-41101545 ATTAACACTGGGGAAATGAGGGG + Exonic
1148022786 17:44564530-44564552 CTTCACACGGAGGAAATGATAGG - Intergenic
1149357686 17:55859787-55859809 ATTCTCCCTGGAGGAATAATTGG - Intergenic
1153936357 18:9928124-9928146 ATTCATATTGGGCAAATGATAGG + Intronic
1157109699 18:44809026-44809048 ATTCTCACTGGGAAAAGAAAAGG - Intronic
1157779749 18:50427761-50427783 ATTCATCCTGGGGACATAGTGGG + Intergenic
1158932706 18:62336627-62336649 TTTCACACTGGGAGAATAAAGGG + Intronic
1159306015 18:66643312-66643334 ATCCACACTATGGAACTAATAGG - Intergenic
925131128 2:1494860-1494882 AGTCACACTGGGGAAAGGACAGG - Intronic
925653303 2:6116292-6116314 ATTCACACTGAGAAATAAATGGG - Intergenic
928918660 2:36502416-36502438 ATTCACACTTAGGAAGAAATAGG + Intronic
931629158 2:64283920-64283942 ATTCACACTGGGGTAGGAGTAGG - Intergenic
935405965 2:102709046-102709068 ACTCAAACTGGGCAAACAATCGG + Exonic
937156926 2:119726385-119726407 ATTTATCCTGAGGAAATAATTGG + Intergenic
939429925 2:142090594-142090616 GTTCAAAATGTGGAAATAATTGG - Intronic
940092205 2:149933401-149933423 ATTTACAGTTGGGAAATGATAGG - Intergenic
940334717 2:152513877-152513899 ATTCACTTTGGGGAACTATTTGG + Intronic
941132094 2:161664039-161664061 ATTCACACTGGTGAAATGTTAGG + Intronic
943374944 2:187065067-187065089 AGACACAGTGGAGAAATAATTGG - Intergenic
944098587 2:195996895-195996917 ATGCCCACTGGGGGAATAGTAGG - Intronic
945180871 2:207089896-207089918 TTTAAAACTGGGGAAATAATGGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945636721 2:212363722-212363744 ATTTACACTGGAAAATTAATTGG + Intronic
945745627 2:213717469-213717491 ATTCACACTGGAGATAGAAAAGG - Intronic
945837634 2:214851674-214851696 ACTCATACTTGGTAAATAATGGG - Intergenic
945876423 2:215282675-215282697 AATCACTCTGGGGAATTATTTGG + Intergenic
1169688318 20:8301767-8301789 ATTTATCCTCGGGAAATAATTGG + Intronic
1173629194 20:44497618-44497640 CTTCACACTGGCAAAATAAGGGG + Exonic
1174850767 20:53992249-53992271 ATTGACATTTGGGAAATACTGGG + Intronic
1175745901 20:61456925-61456947 ATTCACAATGGGGTAATAAATGG + Intronic
1177257282 21:18681934-18681956 TTTAACACTGGGAAATTAATTGG + Intergenic
1178043599 21:28669403-28669425 AAACACAGAGGGGAAATAATTGG - Intergenic
1178809765 21:35870832-35870854 ATTCTCATTGGGGAAAAAAATGG + Intronic
1182798245 22:33007074-33007096 ATTTACACTAGCGAAATACTGGG + Intronic
1183392786 22:37555226-37555248 ATGCACACTGGGGAGAGCATGGG + Intergenic
1184243477 22:43223522-43223544 ATTCCCACTGGGGAAAGGAACGG + Intronic
949738375 3:7200681-7200703 ATTATCACTGGGGAACTTATTGG - Intronic
950414063 3:12858354-12858376 CTGCACACTGGGTAAACAATGGG - Intronic
952576352 3:34778698-34778720 ATTGGCAGTGGGGAAATAAATGG + Intergenic
956652677 3:71519708-71519730 AAACACACTGGGGGAAGAATTGG - Intronic
956763836 3:72467148-72467170 ATTCACACTGAGGAAACAGGGGG + Intergenic
958688527 3:97430133-97430155 ATTCAAACTGATGAAAAAATTGG + Intronic
959837676 3:110939612-110939634 ATACAAAGTGAGGAAATAATTGG + Intergenic
959950944 3:112179595-112179617 ATGCTCAGTGGAGAAATAATAGG - Exonic
960987248 3:123288954-123288976 ATCCAAACTGGGGAAAGAAATGG - Intronic
962379396 3:134885426-134885448 ATAATCACTGGGGAAAGAATGGG - Intronic
963477840 3:145829566-145829588 ATTCACACACTAGAAATAATAGG - Intergenic
964084571 3:152800465-152800487 ATTTACACTGGAGAGATCATAGG - Intergenic
965862877 3:173168518-173168540 ATTAAGACTGGGGAAATAGTTGG + Intergenic
967493159 3:190116375-190116397 CTGCAAAATGGGGAAATAATGGG - Intronic
967537059 3:190617488-190617510 ATTCAGAATGAGGAACTAATGGG + Intronic
971539108 4:27792721-27792743 ATTCATACTGGGGAAGGAAGAGG - Intergenic
973847329 4:54926395-54926417 ATTCAGACTGTGGAACTAACTGG + Intergenic
975138101 4:70893925-70893947 GTATACACTGGGGACATAATAGG - Intergenic
976417639 4:84797215-84797237 ATTAATAATGGGGAAAAAATGGG - Intronic
976504128 4:85826598-85826620 GTACTCACTGGGGAAATAAGAGG + Intronic
977315119 4:95437043-95437065 TTTCTCACTGAGGAAATAAAGGG + Intronic
980035571 4:127879657-127879679 ATTCACACTTTAGAAATAAGGGG + Intergenic
981773566 4:148338244-148338266 ATTAACACTGTAGAAATAACAGG - Intronic
982814742 4:159870743-159870765 ATACAAATTTGGGAAATAATAGG - Intergenic
982862710 4:160473422-160473444 ATTCACACAAGGGATATTATAGG + Intergenic
985047107 4:185951573-185951595 ATCCACACTGAGAAAATAACAGG - Intronic
988970181 5:36459026-36459048 ATTCCCACTAGGGAAATGCTGGG + Intergenic
992283401 5:75205801-75205823 ATTCACTCTGGAGGAATCATTGG + Intronic
993186723 5:84631271-84631293 AGTCACTCTGGGAAAACAATTGG - Intergenic
993398380 5:87418744-87418766 ATTCTCACTGGATAAATAAAAGG + Intergenic
993929909 5:93925429-93925451 ACTAATACTGGGCAAATAATGGG - Intronic
995160817 5:108978903-108978925 ATTCAGATTGGAGAAATTATTGG + Intronic
997257399 5:132439552-132439574 ACTCAAACTGGGGAAAACATGGG + Intronic
1001497773 5:172201905-172201927 ATCCACATTGGGGAAACAAGTGG + Intronic
1001723230 5:173873980-173874002 ATTTATAATGGGGAAAAAATTGG - Intergenic
1005674793 6:28142330-28142352 ATTCAGACTCTGGAAATAGTTGG - Intronic
1006750770 6:36375487-36375509 ATTCACACTGAGGTATAAATGGG - Intronic
1007350260 6:41268095-41268117 ATTCAAGCGGGGGAAATGATTGG + Intronic
1009431413 6:63570818-63570840 TTTCACACTGGGGGAAATATTGG - Intronic
1010291683 6:74144976-74144998 ATTTCAACTGGGGAAGTAATAGG + Intergenic
1011463441 6:87630487-87630509 ATTAACACCGGGCACATAATAGG - Intronic
1015070743 6:129089414-129089436 ATTCACCCTGGAGAAATACCTGG - Intronic
1015477259 6:133667714-133667736 AGTCACCCTGGAGAAATCATGGG + Intergenic
1017038040 6:150284876-150284898 TTTTAGACTGGGTAAATAATTGG + Intergenic
1019096945 6:169589540-169589562 ATTCTCACTGAGGAAACAAAAGG - Intronic
1020377547 7:7504989-7505011 ATTCTCTCTGGGGAAAGAAATGG - Intronic
1023256414 7:38317330-38317352 ACACACACTGGGGAAAAAAATGG + Intergenic
1023564788 7:41513408-41513430 ATGCACAATAGGGAAAGAATTGG - Intergenic
1024044725 7:45578836-45578858 ATTCACACTGGTCAAAAAGTGGG - Intronic
1026144732 7:67736781-67736803 GTTCATAAAGGGGAAATAATTGG + Intergenic
1026342685 7:69447789-69447811 ATTTACACTGAGGAAAGACTAGG - Intergenic
1027541393 7:79471191-79471213 ACTCACACTGAGAAAATAACAGG - Intergenic
1028668702 7:93376005-93376027 ATTCACACTGGGTAAAAGAAGGG - Intergenic
1029684515 7:102137200-102137222 ATTTACAGAGGGGAAATCATTGG - Intronic
1030103042 7:105962828-105962850 ATTCAGACTTGGGAATTAACTGG - Intronic
1031207890 7:118784835-118784857 ATTCACAATGGTCAAATGATGGG - Intergenic
1032224326 7:130018681-130018703 ATTCCCACTGCCGAAATATTCGG + Exonic
1033978786 7:147137811-147137833 TTTCAACCTGGGTAAATAATTGG + Intronic
1034568662 7:151936691-151936713 ATTCTAAGTGGGGAAATGATAGG - Intergenic
1035439813 7:158887379-158887401 ATTCAGAATGAGCAAATAATTGG + Intronic
1036714244 8:11105802-11105824 ACTCTCACTGGGGAAATACATGG + Intronic
1037054195 8:14417440-14417462 ATAATCACTGGGGAAATAATTGG - Intronic
1037198294 8:16219174-16219196 ATTAGCAATGGGGAAATAAATGG - Intronic
1038707197 8:29905602-29905624 TTTCACGCTTGGGAGATAATTGG - Intergenic
1039006275 8:33040869-33040891 ATTCAGACTGAGAAAATATTTGG - Intergenic
1040496278 8:47968295-47968317 CTTCACACTGGGGAAGAAACAGG - Intronic
1041523791 8:58783700-58783722 ATTCACACTATGGAAATCCTAGG + Intergenic
1041729892 8:61052679-61052701 GATCACTCTGGAGAAATAATGGG + Intergenic
1042050291 8:64697036-64697058 AATCACACAGGGGAAAAAAAGGG + Intronic
1043838306 8:85069551-85069573 TTTCACAATGGTGAAATAAAGGG + Intergenic
1046358567 8:113119771-113119793 TTTCTTACTGGGTAAATAATGGG + Intronic
1047469528 8:125155889-125155911 ATTCTCACAGGGAAAATGATGGG + Intronic
1049015635 8:139918179-139918201 ATCCAAACTGAAGAAATAATGGG - Intronic
1052236712 9:26219483-26219505 ATTCAAACTAGGGAAACATTTGG - Intergenic
1055212917 9:73819885-73819907 ATTGACAGTGTGGAAATAAGAGG + Intergenic
1055398364 9:75897259-75897281 ATTGTCCCTGGGGATATAATGGG + Intronic
1056676276 9:88679325-88679347 CTTCACTCTTGGCAAATAATTGG + Intergenic
1058886352 9:109324286-109324308 ATTCACACTGGGCATAAAAGAGG - Intergenic
1059819040 9:117951328-117951350 AATCACACTGGGGACAGAAAAGG - Intergenic
1059847973 9:118302788-118302810 ATTCAGACTGGGGACAAAATGGG - Intergenic
1187414772 X:19083653-19083675 ATGCACGCTGGGGAAAGAATGGG + Intronic
1188087047 X:25912287-25912309 ATACCCAATGGAGAAATAATAGG - Intergenic
1189608458 X:42705105-42705127 ATTCACAGTGAGTAAATAAGTGG - Intergenic
1192192172 X:68997648-68997670 ATTCATCCTAAGGAAATAATGGG + Intergenic
1192598247 X:72434312-72434334 ATATACACTAGGGATATAATTGG + Intronic
1194651021 X:96514512-96514534 ATACACAATGGGGAAAGAAAAGG + Intergenic
1195402543 X:104476894-104476916 AGACACTGTGGGGAAATAATAGG + Intergenic
1196501374 X:116387140-116387162 ATTCACACTGGGTAGATCAGAGG - Intergenic