ID: 1095154047

View in Genome Browser
Species Human (GRCh38)
Location 12:38831243-38831265
Sequence ATGAGGGCCCTCTCTGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095154047_1095154054 3 Left 1095154047 12:38831243-38831265 CCAAGCCCAGAGAGGGCCCTCAT 0: 1
1: 0
2: 0
3: 19
4: 254
Right 1095154054 12:38831269-38831291 CAGACACAAAAGTTGTCTTAGGG 0: 1
1: 0
2: 1
3: 13
4: 194
1095154047_1095154053 2 Left 1095154047 12:38831243-38831265 CCAAGCCCAGAGAGGGCCCTCAT 0: 1
1: 0
2: 0
3: 19
4: 254
Right 1095154053 12:38831268-38831290 CCAGACACAAAAGTTGTCTTAGG 0: 1
1: 0
2: 0
3: 12
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095154047 Original CRISPR ATGAGGGCCCTCTCTGGGCT TGG (reversed) Intronic