ID: 1095154971

View in Genome Browser
Species Human (GRCh38)
Location 12:38841857-38841879
Sequence AGGGAGAAGCAGAAAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1431
Summary {0: 1, 1: 1, 2: 10, 3: 141, 4: 1278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095154967_1095154971 -4 Left 1095154967 12:38841838-38841860 CCTGTGACTTCCTTTCCACAGGG 0: 1
1: 1
2: 2
3: 23
4: 277
Right 1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG 0: 1
1: 1
2: 10
3: 141
4: 1278
1095154964_1095154971 7 Left 1095154964 12:38841827-38841849 CCTCCAGAAGTCCTGTGACTTCC 0: 1
1: 0
2: 1
3: 23
4: 227
Right 1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG 0: 1
1: 1
2: 10
3: 141
4: 1278
1095154965_1095154971 4 Left 1095154965 12:38841830-38841852 CCAGAAGTCCTGTGACTTCCTTT 0: 1
1: 0
2: 0
3: 26
4: 274
Right 1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG 0: 1
1: 1
2: 10
3: 141
4: 1278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095154971 Original CRISPR AGGGAGAAGCAGAAAGATGA AGG Intronic
900757944 1:4450397-4450419 AGGGAGAAACAGGAAGACAAAGG - Intergenic
900784033 1:4636501-4636523 GAGGAGAAAAAGAAAGATGACGG + Intergenic
901139844 1:7021380-7021402 AGAGAGAAGCTGAGCGATGAGGG - Intronic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
901755980 1:11441857-11441879 AGAGAGGAGGAGGAAGATGAGGG + Intergenic
901755985 1:11441876-11441898 AGGGAGGAGGAGGAAAATGAGGG + Intergenic
901896117 1:12313734-12313756 AGCTAGAAGCTGACAGATGAAGG + Intronic
902654761 1:17859610-17859632 AGGGAGAGAGAGAAAGATGGGGG + Intergenic
902873880 1:19329557-19329579 AGGAAGAAGCAGAATGGTTAAGG + Intergenic
902989919 1:20180053-20180075 AGGGAGAAGCTGACACATAATGG - Intergenic
903011056 1:20330725-20330747 AGGGAGAGGGAGAAGGAAGAGGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903236182 1:21952241-21952263 AGTGAGACTCAGAGAGATGACGG + Intergenic
903242442 1:21992436-21992458 AAGGTGAAGCAGGAACATGAAGG + Intronic
903245952 1:22015621-22015643 AAGGTGAAGCAGGAACATGAAGG + Intergenic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
903648713 1:24910391-24910413 AGGGAGAAGAGGCAAGATGTAGG + Intronic
904078830 1:27859154-27859176 AAGGGGAAGCAGAGAGGTGACGG - Intergenic
904229750 1:29058686-29058708 AGGGAGAAGAAAAAAACTGAGGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904470649 1:30733919-30733941 TGGGAGAGACAGAGAGATGAGGG + Intronic
904770223 1:32876982-32877004 AGGCAGAGGCAGCAAGATGCAGG - Intergenic
904920139 1:34000982-34001004 GGGGAGAAGGAGAAAGGGGAAGG + Intronic
905312785 1:37062026-37062048 ATGGACAAGCTGAAAGTTGATGG + Intergenic
905498631 1:38418023-38418045 AGTGAGAATAAGAAAAATGATGG - Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905872900 1:41415251-41415273 AGGGAGAAGCAGGAAGGTGGAGG - Intergenic
906109396 1:43312934-43312956 AAGGAGAAGCAGAAGCTTGAGGG + Intronic
906174743 1:43761505-43761527 AGAGAGAAGGAGAAAGAAAAGGG + Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906529129 1:46513084-46513106 AGAGACAAGGAGAAAGATCAAGG - Exonic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
906956233 1:50377158-50377180 AGGCAGAGGCAGAATTATGAAGG + Intergenic
907484657 1:54768860-54768882 AGGCAGCAGCAGTAGGATGAGGG - Intergenic
907610364 1:55863653-55863675 AGGCAGGAGGAGAAATATGAGGG - Intergenic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
907804827 1:57807790-57807812 AGGGAGGAGGAGAAAAAAGAGGG - Intronic
907862700 1:58368799-58368821 TGGGACAAGCAGAAATATCAGGG + Intronic
908427160 1:64018282-64018304 AAGGAGAAGCAGGAAACTGAGGG - Intronic
908949383 1:69541214-69541236 ATGAAAAGGCAGAAAGATGAGGG - Intergenic
909086671 1:71176383-71176405 AGGAAGAAGAATAAAAATGATGG - Intergenic
909323625 1:74321505-74321527 AGGGAGGAGAAGTGAGATGAGGG - Intronic
909642971 1:77887904-77887926 AAGAAGAAGAAGAAAGTTGAAGG - Intergenic
910039699 1:82834869-82834891 AGTGAGAAGCAGGAAGAAGAAGG - Intergenic
910336604 1:86139165-86139187 AGGGAGAAGGAGAAAGGGGGGGG + Intronic
911406355 1:97445283-97445305 AAGGTGAAGCAGAGACATGAAGG - Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
911664064 1:100534424-100534446 ACAGAGATGGAGAAAGATGAAGG - Intergenic
911667456 1:100569684-100569706 AGGGATAAGCAGGAAGGTAAAGG - Intergenic
911720539 1:101186734-101186756 GGGGAGAAAGAGAAAGAAGAAGG - Intergenic
911906686 1:103577983-103578005 GGGCAGAAGTAAAAAGATGATGG + Intronic
911910191 1:103624361-103624383 GGGCAGAAGCAAAAGGATGATGG + Intronic
911913287 1:103663151-103663173 GGGTAGAAGCAAAAGGATGATGG + Intronic
911915167 1:103688796-103688818 GGGTAGAAGCAAAAGGATGATGG - Intronic
911917609 1:103718486-103718508 GGGCAGAAGCAAAAGGATGATGG + Intronic
911920700 1:103757289-103757311 GGGTAGAAGCAAAAGGATGATGG + Intronic
912096997 1:106158174-106158196 AGGCTGAGGCAGGAAGATGAAGG - Intergenic
912498622 1:110107257-110107279 TGGGAGAAGCAGGAGCATGAAGG - Intergenic
912703431 1:111895142-111895164 AGGGAGAAGGAGAAGGAAGGAGG + Intronic
912723338 1:112038265-112038287 GGTGATGAGCAGAAAGATGAGGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
914919283 1:151836925-151836947 AGGGAGAGGGAGAAAGAAGTTGG + Intergenic
914941693 1:152028849-152028871 AGAGAGAAAGAGAGAGATGAGGG + Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915089580 1:153415295-153415317 AGGAAGTTGAAGAAAGATGATGG + Intergenic
915095923 1:153461835-153461857 AGGAAGTTGAAGAAAGATGATGG - Intergenic
915362457 1:155294416-155294438 AGGCAGGAGAAGAAAGGTGATGG + Intronic
915845293 1:159257340-159257362 GGGGAGAAGGAGAGAGATGGGGG + Intergenic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916333734 1:163646524-163646546 AAGGAGAAGAACAAAGTTGAAGG - Intergenic
916374380 1:164136260-164136282 AGGGAGAAATAGGGAGATGATGG + Intergenic
916376356 1:164157824-164157846 AGGCAGAAGAAGAAAGATCAGGG + Intergenic
916397278 1:164404977-164404999 AATGAGAAGCAGAAAAGTGAAGG - Intergenic
916869781 1:168901180-168901202 AGCACGAAGAAGAAAGATGAAGG + Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917471648 1:175330877-175330899 AGGAAGAAGCAGATGAATGAGGG - Intronic
917644311 1:177014894-177014916 AGGAAGAAAGAGAAACATGAAGG + Intronic
917678201 1:177340229-177340251 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
917975668 1:180235990-180236012 CGGGAGCAGCAGGAAGTTGAAGG + Intronic
918374487 1:183895439-183895461 AGGGAGAAGGAGATTGATGGAGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919133279 1:193477288-193477310 GAGGGGAAGTAGAAAGATGATGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919329565 1:196153201-196153223 AGGGGGAAGCGGGAAGATGTTGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919513140 1:198491159-198491181 AGAGAGCAGCAGGAAGAAGATGG + Intergenic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
919777266 1:201202425-201202447 AGGAATAAGCAGAGAGGTGAGGG - Intronic
919856797 1:201711653-201711675 AGGGAGTGACAGAAAGATGATGG - Intronic
920032334 1:203044913-203044935 AGGGAGAAGAAGAAAAGAGAAGG - Intronic
920063258 1:203244020-203244042 AGGAAGAAGAAGAAAGAAAAAGG + Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920081470 1:203376928-203376950 AAGGAGAAGAAGAGAGATGGGGG + Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
921557086 1:216611900-216611922 ATGAAGAAGCAGAAATATGGAGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922697899 1:227740879-227740901 GGGGAGGAGCTGAAAGCTGAAGG + Intronic
922720870 1:227899709-227899731 AGAGAGACGGAGAAAGATGGAGG - Intergenic
922722751 1:227906882-227906904 AGGGAGAAGCAGAAGGGAAAGGG - Intergenic
923098503 1:230794069-230794091 AGGAAGAAGCAGAAAGACCCTGG + Intronic
923370188 1:233302618-233302640 AAGGAGAAGCAAAAAAATGCAGG - Intergenic
923375275 1:233355873-233355895 AAGGAGAAGGGGACAGATGAGGG - Intronic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
924105280 1:240643291-240643313 AGGAAAAAGCAGAAAAATGTAGG - Intergenic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924428549 1:243976545-243976567 AGGGTGAAGCACAAAGAACAGGG + Intergenic
924498004 1:244608679-244608701 AGGGAGAAGGAGAAAGCAGAGGG - Intronic
924557454 1:245130071-245130093 AAAGAGAAGCAGAAAGAAAATGG + Intergenic
924761384 1:246990079-246990101 AGGGAGAAAGAGAGAGAAGAAGG + Intronic
1062970504 10:1644458-1644480 AGGGAGAAGGAGAAGGACAAAGG + Intronic
1063007350 10:1985998-1986020 AGGGAAAAACAAATAGATGAAGG + Intergenic
1063009026 10:2004352-2004374 AGGGAGAAGCTGAACAGTGATGG + Intergenic
1063025113 10:2170426-2170448 AGAAATAAGCAGAAAGATGGGGG - Intergenic
1063343127 10:5286990-5287012 GAGGAGAAGGAGGAAGATGAAGG - Intergenic
1063539576 10:6918686-6918708 AGGGAGGAGTAGAAGGATGGAGG + Intergenic
1063614492 10:7590154-7590176 AGGGAGATTTAAAAAGATGAAGG - Intronic
1063614809 10:7592491-7592513 AGAGAGAAACAGAAAGAGTAGGG + Intronic
1063732137 10:8709924-8709946 AGGAAGGAAGAGAAAGATGAAGG - Intergenic
1063744320 10:8862612-8862634 GGGGAGAAGGAGAAGGATGTGGG - Intergenic
1064317819 10:14274659-14274681 AGGGAGAATTGGAAAAATGAAGG + Intronic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1064720480 10:18224314-18224336 AGGGAGAAGTTGAAAGAGGGAGG - Intronic
1064724940 10:18269747-18269769 AGGGAGGAGCAGAGAGAGGGAGG - Intronic
1064804352 10:19113593-19113615 AGGGAGAAGAAGGAAGAAAAAGG - Intronic
1064906081 10:20347544-20347566 AGGCAGAAGCAGAGAGGAGAGGG - Intergenic
1064911749 10:20409608-20409630 AAGGAAAAGGAGAAAAATGAGGG - Intergenic
1065043099 10:21717542-21717564 AGAAAGAAGAAGAAAGAAGAAGG - Intronic
1065127574 10:22588519-22588541 AGGAAGAGGCAGAAAGATAAAGG - Intronic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065456726 10:25914154-25914176 AATGAGAAGGAGAAAGATGGGGG + Intergenic
1065602929 10:27388102-27388124 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066244847 10:33572322-33572344 AGGATGAAGAAGAGAGATGAAGG - Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066539419 10:36429196-36429218 AGGGAGAAGAAAAAAGCAGAGGG - Intergenic
1066548351 10:36526410-36526432 AGGAAGAAGCAAAAATATCATGG + Intergenic
1067128146 10:43537772-43537794 AGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1067844602 10:49709834-49709856 AGGGAGAAGGGGAAAGATTATGG - Exonic
1068505218 10:57891677-57891699 AGGGAGAAACTGAAAGAAGGTGG - Intergenic
1068724825 10:60289362-60289384 GGGGAGAAGAAGAAAGAGGGTGG - Intronic
1068817106 10:61329429-61329451 AAGGAGAAGAACAAAGTTGACGG - Intergenic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069123666 10:64602281-64602303 AGGGAGGGGAAGAACGATGAGGG + Intergenic
1069319065 10:67145057-67145079 AAGGAGAAGGAGAAAGCTGGAGG + Intronic
1069369404 10:67730682-67730704 AGGGAGAAAGAAAAAGATAAAGG + Intergenic
1069529845 10:69208996-69209018 AGGGACGAGAAGAAAGAAGAAGG + Exonic
1069557304 10:69406758-69406780 AGGGAGGGCCAGAGAGATGAAGG - Intronic
1069769734 10:70890551-70890573 TGGTAGCAGCAGAAAGTTGAAGG - Intergenic
1069893215 10:71664835-71664857 AGGGAGGAGGAGAAGGAAGAGGG - Intronic
1069987488 10:72294299-72294321 AGGGAGAAGAGGAAGAATGAAGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070574986 10:77670935-77670957 AGGGAGAAACAGAAAGAGAGAGG + Intergenic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1071347928 10:84711015-84711037 AGGAAGAAGAAGAAGAATGAGGG - Intergenic
1071877817 10:89861504-89861526 AGGCAGAAGAAGAAAGAAGAAGG - Intergenic
1072271275 10:93779491-93779513 AGGGAGAAAGAAAAAGAGGAAGG + Intronic
1072313256 10:94177670-94177692 AGCTAGATGCAGGAAGATGAAGG - Intronic
1073028797 10:100508350-100508372 GGAGAGAAGGAGGAAGATGAGGG + Intronic
1073127584 10:101161309-101161331 AGGGAAGGGCAGAAATATGAAGG + Intergenic
1073689160 10:105788127-105788149 AAGGAGAAGGAGATAGAAGAAGG - Intergenic
1074185506 10:111097037-111097059 AGGGAGAGACAGAGAGATGGAGG + Intergenic
1074817365 10:117152528-117152550 AGAGCAAAGAAGAAAGATGAAGG + Intergenic
1074866766 10:117548505-117548527 AGAGAGAAGGAGAAAGAGGGAGG + Exonic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1075193339 10:120331567-120331589 AGGGAGAAGAAGAGAGGTGGAGG - Intergenic
1075291978 10:121238489-121238511 AAGGAGAAGCATAAAGGAGATGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075445214 10:122508300-122508322 TGGGAGAAGCAGGAAGGTGTGGG + Intronic
1075838605 10:125477672-125477694 AGGGAGAGGAGGAAAGAAGAAGG + Intergenic
1075889574 10:125935065-125935087 AGAAACAAGCAGAGAGATGAAGG - Intronic
1075937642 10:126356924-126356946 AGGAACAAACAGAAAAATGAAGG + Intronic
1076252394 10:128994764-128994786 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1076587499 10:131559607-131559629 AGTGAGAAACAGAGAGCTGAGGG + Intergenic
1077032343 11:474230-474252 AGGCAGAAGCAGGAAGAGAAGGG - Intronic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1077743741 11:4877391-4877413 AGGGAGAAGCAGGTAGATATTGG - Intronic
1078096789 11:8302446-8302468 AGAGAGAAGAAGAAAGGAGAAGG + Intergenic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078935075 11:15942654-15942676 AGGAAGAAGCAAAAGGAAGAAGG + Intergenic
1079089177 11:17468874-17468896 AGGCAGAAGCAACAGGATGATGG - Intronic
1079130764 11:17745645-17745667 AGAGAGAAGCAGACAGCAGAGGG - Intronic
1079445569 11:20553675-20553697 AAGGAGAAGGAGAAAGAAAAAGG - Intergenic
1079449560 11:20588044-20588066 AAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1079645156 11:22853703-22853725 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1079745679 11:24125830-24125852 ATGAGGGAGCAGAAAGATGAAGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1079950130 11:26791513-26791535 AGGAGGAAGCTGCAAGATGAGGG + Intergenic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080278581 11:30530662-30530684 AGGGAAAATCAGAAATAAGAAGG + Intronic
1080357958 11:31473379-31473401 ACTGAGGAGCAGAGAGATGAAGG + Intronic
1080397878 11:31906596-31906618 AGGGAGAGACAGAAAGAGAAGGG + Intronic
1080412485 11:32038817-32038839 AGGGAGATGCAGAAAGGAAATGG + Intronic
1080759905 11:35238393-35238415 AGGTAAAACCAGAAAGAAGAGGG + Intergenic
1080805961 11:35653803-35653825 AGGGAAAATCATAAAGATAAAGG + Intergenic
1081007781 11:37768957-37768979 AGGGAGAAGGAGAGAGACAAAGG + Intergenic
1081362341 11:42195968-42195990 AGGGAGAAAAAGAAAGAGAAAGG - Intergenic
1082143564 11:48638625-48638647 AGGGAGAAGAAAAGAGATGTTGG - Intergenic
1082282826 11:50288494-50288516 AAGGAGAAGCAGGATGATAATGG - Intergenic
1082809197 11:57468344-57468366 AGGCAGAGGCAGAGAGGTGAAGG - Intronic
1083040132 11:59677872-59677894 AAAGAGAGGGAGAAAGATGAGGG + Intergenic
1083221801 11:61257622-61257644 AGTGAGAAGGGAAAAGATGATGG - Intergenic
1083315616 11:61813364-61813386 CGGGAGAAGATGAAAGGTGAGGG + Intronic
1083540129 11:63506619-63506641 TGGGAGAAGCAGAAAGACTGAGG - Intronic
1083609172 11:63997015-63997037 AGGGAGAAAGGGCAAGATGACGG - Intronic
1083682594 11:64358329-64358351 AGGGAAAGGCAGGAAGAAGACGG + Intergenic
1083687368 11:64384636-64384658 AGGGAGAATCAGAAAGAGTGGGG - Intergenic
1083888114 11:65582498-65582520 AGAAAGAAGCAGCAAGATCAAGG + Exonic
1084026666 11:66454787-66454809 AGGGAAGAGCAGACAGAGGAGGG - Intronic
1084893318 11:72247882-72247904 AGGGACAAGCAGAGATATAAGGG + Intergenic
1084936198 11:72588034-72588056 GGGGAGAAGTAGACAGATGAGGG - Intronic
1085143651 11:74172132-74172154 AGGGAGAATGAGAAAGTTTAGGG + Intronic
1085235159 11:75008974-75008996 AGGGGGAAGAAGTAAGAGGAGGG - Exonic
1085316637 11:75548993-75549015 AGCTAGAAGCAGAAGGATGCAGG + Intergenic
1085646291 11:78225194-78225216 AGGAAGAAGCTGACAGAGGAAGG + Exonic
1085684580 11:78610119-78610141 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1085807658 11:79651052-79651074 AAGGAGAAGAAGGAAGATGGAGG - Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086329428 11:85738842-85738864 AGGGGAAAGGAGAAAGATGGTGG - Intronic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1087152859 11:94874062-94874084 AGGGTGAAGCAGAACAATGCTGG - Exonic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087973613 11:104516656-104516678 GAAGAGAAGGAGAAAGATGAGGG - Intergenic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1089216905 11:116839818-116839840 AAGGACAAGCAGAGAGATGTGGG - Intergenic
1089384254 11:118057639-118057661 TGGGAGAAGAACAAGGATGAAGG + Intergenic
1089454027 11:118615413-118615435 GGGCAGAAGCTGAAAGGTGAAGG - Intronic
1089690966 11:120186505-120186527 GGGGAGGAGCAGGCAGATGAAGG - Intergenic
1089739353 11:120571678-120571700 AGGAAGAAGAGGAGAGATGAGGG - Intronic
1089858021 11:121564224-121564246 AGAGAGAAGCTGGAAGAAGATGG - Intronic
1090066211 11:123505841-123505863 AGGGAGAGAAAGAAAGAAGAAGG - Intergenic
1090125245 11:124077410-124077432 AGAGAGAAAAAGAAAGAAGATGG - Intergenic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090685648 11:129115592-129115614 AGTGAGCATCAGTAAGATGAGGG - Intronic
1091016362 11:132054539-132054561 AGGGAGAGGCAGATGGATGGAGG + Intronic
1091038559 11:132255702-132255724 AGTCAGCAGCAGAAAGGTGAAGG - Intronic
1091195434 11:133726895-133726917 AGGGACCAGCAGAAAGAAGCAGG - Intergenic
1091363974 11:135001661-135001683 ACGGAGAAGCAGGAAGGAGAGGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091603157 12:1930007-1930029 AGGGAGGAGGAGGAAGAAGAGGG + Intergenic
1092084385 12:5743565-5743587 AGGGAGGAGGAGAAAAATGAAGG + Intronic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092588939 12:9932592-9932614 AAGGAAAAAAAGAAAGATGATGG - Intergenic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1092944734 12:13442176-13442198 AGGGAGAAGTGGAAAGAGAAGGG - Intergenic
1092965105 12:13633851-13633873 AGGGAGAATCAGAAACAGGTGGG - Intronic
1093007460 12:14065770-14065792 AGAGAGAAGCAGAAAGAGTTAGG - Intergenic
1093372814 12:18385447-18385469 GGGGAGAGGCAGGAAGTTGAAGG - Intronic
1093410166 12:18855769-18855791 AGAGAGAAGGACAAAGATGGAGG + Intergenic
1093687024 12:22068398-22068420 AAGAAGAGGAAGAAAGATGAGGG + Intronic
1093743720 12:22716067-22716089 AGGAAGGAGCAGAGGGATGAAGG + Intergenic
1093940059 12:25043261-25043283 AGGGAGAAGCTGAGAGCTGGAGG - Intronic
1094006008 12:25752166-25752188 TGGGAGATGCAGAAAGCTCACGG + Intergenic
1094129871 12:27063353-27063375 AGGAGGAAGAAGAAAGAAGAAGG - Intronic
1094309705 12:29066073-29066095 AGGCAGAAGAAGAAAAATGTTGG + Intergenic
1094339390 12:29393646-29393668 AGGGAGAAGAGGAAGGGTGAAGG + Intergenic
1094348841 12:29500388-29500410 AGGAAGAAGTAAAAAGATGAAGG + Intergenic
1094827080 12:34277835-34277857 AGGGAGGAGGAGAAGGATGGAGG - Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095290377 12:40472817-40472839 AGGGAGGAGGAGGAAGAGGAGGG - Intronic
1095328910 12:40933101-40933123 AGGGAGAAGGAAAGAGAAGAAGG - Intronic
1095404180 12:41849481-41849503 TGGGAGAAGGGGAAAGATAAAGG - Intergenic
1095466899 12:42497194-42497216 AAGGAGGAGGAGAAAGATGAGGG + Intronic
1095480005 12:42625010-42625032 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1095523078 12:43091659-43091681 TGGGAGAGGGAGAAAGATGGGGG - Intergenic
1095566576 12:43631361-43631383 AGGGAGTAGCAGAAAAGAGAAGG - Intergenic
1095714151 12:45323416-45323438 AGAGAGAAGAAGCAAGATGCAGG + Intronic
1095936872 12:47693245-47693267 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1095985990 12:48000143-48000165 AGGGAGAAGCAGAGAGCCAAGGG + Intronic
1096046036 12:48563246-48563268 AGGGAGAGGCAGGAAGAAGAGGG - Intergenic
1096064884 12:48731732-48731754 AGAGAGAGGGAGAGAGATGAGGG - Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096983547 12:55742854-55742876 AAGGAGAATCAGAGAGATAAGGG - Intergenic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098649336 12:72944557-72944579 AGGGAAGCACAGAAAGATGAGGG - Intergenic
1098747588 12:74259947-74259969 AGGGGGAAGGGAAAAGATGAGGG + Intergenic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099604421 12:84784127-84784149 AGAGAGAAGGAGAGAGAAGAAGG + Intergenic
1099926927 12:89030122-89030144 AGGGAGAAGAACAAAGGTTAGGG - Intergenic
1100117500 12:91325172-91325194 AAGGAGAGGAAGAAAGATGAAGG + Intergenic
1100285932 12:93166391-93166413 AGAGAGATGAAGGAAGATGAAGG + Intergenic
1100604889 12:96143529-96143551 AGGGCAGAGCAGAAAGAGGAAGG + Intergenic
1100642665 12:96497337-96497359 AAGGAGAAGAAGAAAGTTGGAGG + Intronic
1100672582 12:96833084-96833106 TGAGAATAGCAGAAAGATGAAGG + Intronic
1100700243 12:97139669-97139691 AGTGAGTAGCAGGAAGATGAAGG - Intergenic
1100997483 12:100318250-100318272 AGAAAGAAGCAGAAAGATGAAGG - Intronic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1101794108 12:107957020-107957042 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1102133957 12:110557030-110557052 AGGGAGAAGCTGAAAAATGAAGG + Intronic
1102394517 12:112575024-112575046 AGGGAGAGGGAGGAAGAGGAGGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102577007 12:113862056-113862078 AAGGAGGAGCTGAAAGATCAGGG + Intronic
1102682231 12:114698626-114698648 AGGGAGATGGAGAGAGAGGAGGG - Intergenic
1102871878 12:116420141-116420163 AGGAAGAAAAAGAAAAATGAGGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103005097 12:117414666-117414688 AGGGAGAGGCAGTAAAATGCTGG - Intronic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103219488 12:119231946-119231968 AGGAAGAAGAAGAAAGAAGGAGG - Intergenic
1105337720 13:19489045-19489067 AAGGAGAAGGAGAAAGATGGGGG + Intronic
1105408188 13:20148944-20148966 AGGCAGAACCAAAAAGATTAAGG - Intronic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1106419450 13:29573428-29573450 AGGAAGTAGCACACAGATGATGG + Intronic
1106547926 13:30746335-30746357 AGAGGGAAGGAGAAGGATGAGGG + Intronic
1106816224 13:33410303-33410325 AAGCAGAAGCAGAAAAATGTAGG + Intergenic
1107148555 13:37086200-37086222 GGTGAGAAGGAGAAAGAGGAGGG + Intergenic
1107160420 13:37219524-37219546 AAGGAGAAGAACAAAGTTGAAGG - Intergenic
1107843383 13:44483791-44483813 AAGGACATGCAGAAAGATGCTGG + Intronic
1107905372 13:45056636-45056658 AGGGAGAAACAGAAAAAAGGAGG - Intergenic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1108392090 13:49956508-49956530 AGAAAGAAGAAGAAAGAGGAAGG - Intergenic
1108943285 13:55986674-55986696 AGCAAGAAGAATAAAGATGATGG - Intergenic
1109507206 13:63319468-63319490 GGTGAGAATCAGAAAGATAAAGG - Intergenic
1109642902 13:65214180-65214202 AGGATGAAGCAGGAAGATAAAGG + Intergenic
1109837987 13:67883756-67883778 AGGGAGCAACAGAGAGAGGAGGG - Intergenic
1109953256 13:69530491-69530513 AAGGAGAGGGAGAGAGATGAGGG - Intergenic
1110328745 13:74247469-74247491 TAGGTGAAGAAGAAAGATGAAGG + Intergenic
1110356327 13:74571952-74571974 TAAGAGAAGCAGAAAGATGCAGG + Intergenic
1110386790 13:74921484-74921506 AGAAAGAAGCACCAAGATGAAGG + Intergenic
1110646946 13:77897610-77897632 AGGGAGTAACAGAAAGAGCAAGG - Exonic
1111008908 13:82286609-82286631 AATGAGAAGGAGAAAGATTAGGG - Intergenic
1111568812 13:90051329-90051351 TGGGAGAAAGAGAAAGATAAAGG - Intergenic
1112150706 13:96759344-96759366 AAGGAGAAACAGAAAACTGATGG - Intronic
1112475209 13:99725527-99725549 AGAGGGCAGCAGAGAGATGAAGG + Intronic
1112517838 13:100070830-100070852 TGGGAGAAGGAGGAAAATGAGGG + Intergenic
1112874579 13:104020068-104020090 AGAGAGATGCAGAAAGAAAAAGG + Intergenic
1113585121 13:111459637-111459659 AGGGAGAAAGAGAAAGAGAAGGG + Intergenic
1114120480 14:19666188-19666210 AGGAAGAAGATGAAAGAAGAAGG + Intergenic
1114197986 14:20495714-20495736 AGGGAGAGGAAGGAAGAGGAGGG - Intergenic
1114294743 14:21318982-21319004 AGGAAAAAGTAGTAAGATGAAGG - Intronic
1114522671 14:23348729-23348751 AGAGAGAAGAAGAAAGAGGGAGG + Intronic
1114763327 14:25342789-25342811 AGGGAGAAAAATAAAGATAAAGG - Intergenic
1114928264 14:27432933-27432955 AGAGAGAAACAGAATGATAAAGG + Intergenic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115345835 14:32342587-32342609 AAAGAGCAGCAGAAAGATCATGG - Intronic
1115659106 14:35474438-35474460 AGGAGGAAGAAGAAAGAAGAAGG - Intergenic
1116182609 14:41554210-41554232 AGGGAGAGTGAGAAAGATGAAGG + Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116312042 14:43340153-43340175 AGGAAAGAGAAGAAAGATGAGGG + Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117033700 14:51704629-51704651 AGGGAGGAGCAGAAACAGAAGGG + Intronic
1117079602 14:52137589-52137611 AGGGAGAAGAGGAAGGGTGAAGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117642613 14:57816137-57816159 AGGGAGAATCACAATGATGGTGG + Intronic
1117651459 14:57910720-57910742 AAGGAGAAGCACAAAGTTGGAGG - Intronic
1117849646 14:59954099-59954121 AGGAAGAAGAATAAAGCTGAAGG - Intronic
1118105218 14:62650941-62650963 AGGCAGAAGGAGGAAGAAGATGG - Intergenic
1118180134 14:63484103-63484125 AGTTAGAAGCAGAAAGATAAAGG + Intronic
1118489956 14:66249309-66249331 AGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1118726989 14:68635901-68635923 AAGGAGAGGTAGCAAGATGATGG - Intronic
1119041514 14:71278711-71278733 AGGGAGAAGAAAAGAGAGGAAGG + Intergenic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1119660403 14:76447363-76447385 AGGAAGAACCAGGAAGCTGAAGG - Intronic
1119829263 14:77686494-77686516 AGGCACTAGCAGAAGGATGATGG + Intronic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1120515380 14:85464193-85464215 AGGGAAAGACAGGAAGATGAGGG + Intergenic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121410580 14:93745991-93746013 AGGGAGAAGGGGAAGGATGGGGG - Intronic
1121550097 14:94792834-94792856 AGAGAGAAAGAGAAAGAGGAAGG + Intergenic
1121697842 14:95927940-95927962 AGGGAGAAGGAGAGGGATGGAGG - Intergenic
1121777056 14:96598081-96598103 AGGGAGAAGGGGGAAGAGGAGGG - Intergenic
1121782619 14:96631681-96631703 ATGTAAAAGCAGAAAGGTGATGG - Intergenic
1122032524 14:98923651-98923673 AGGGAAAAAGACAAAGATGAAGG + Intergenic
1122034263 14:98936023-98936045 AGTGAGAAGGAGAAACATGCAGG + Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122072968 14:99216665-99216687 AGGAAGAATCAGAAAGTTCAGGG + Intronic
1122314133 14:100815738-100815760 AGGTAGAGGGAGGAAGATGAGGG - Intergenic
1122332214 14:100929013-100929035 AGGGAGAAGCAGATAGGAAAAGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122861747 14:104585633-104585655 AGAGAGAATCAGAGAGAGGAAGG + Intronic
1122962704 14:105104057-105104079 AGGGAGTCCCAGAAAGATAAGGG + Intergenic
1123661960 15:22572316-22572338 AGGGAGTTGCAGACAGATCAGGG + Intergenic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1125000557 15:34765654-34765676 AAAGAGAAGGAGAGAGATGAGGG + Intergenic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1125152370 15:36547252-36547274 AGAGAGGAGCAGAAAAAAGAAGG + Intergenic
1125279748 15:38031123-38031145 AAGGGAAAGCAGAAAGATGGAGG - Intergenic
1125378125 15:39055475-39055497 AGGAAGAAGGGGAAAGATCAAGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127126661 15:55818920-55818942 AGGGAGAAGCACAATGAAAATGG - Intergenic
1127150569 15:56070676-56070698 AAGGAGAAGAACAAAGATGGAGG + Intergenic
1127163678 15:56220020-56220042 AGGGAACAACAGAAAGATGCTGG - Intronic
1127502845 15:59570753-59570775 AGAAAGAAGAAAAAAGATGAGGG - Intergenic
1127537558 15:59904246-59904268 AGGGAGAAATGGAAAGAAGAAGG + Intergenic
1127556019 15:60088516-60088538 AGGGAGAACGAGAGAGATGAAGG + Intergenic
1127634779 15:60858841-60858863 CGGGAGAAGCACCAAGCTGAGGG - Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128130257 15:65222544-65222566 GTGAAGTAGCAGAAAGATGAAGG - Intergenic
1128304173 15:66587076-66587098 GGGGAGAAGGAGGAAGAGGAAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128680390 15:69647285-69647307 AGGCTGAAGCAGGAAAATGAGGG + Intergenic
1129107992 15:73322443-73322465 AGAGAAAAGAAGAAAGAAGAGGG + Exonic
1129192758 15:73947033-73947055 GGAGAGAAGGAGAAAGAAGAGGG - Intronic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1129698479 15:77754178-77754200 AGGGAGCAGGAGCAAGAGGATGG + Intronic
1130090925 15:80820596-80820618 ACTGAGAATCAGAAAGTTGAGGG - Intronic
1130409852 15:83637242-83637264 AGGGAGAACTAGAGAGGTGATGG - Intergenic
1130896136 15:88171795-88171817 AGGGAGGGGGAGAAAGAAGAAGG - Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131139818 15:89968096-89968118 AGGGAGAGGAAGAGAGAAGAAGG + Intergenic
1131547388 15:93327300-93327322 TGTGAGAATGAGAAAGATGAGGG - Intergenic
1131714430 15:95092896-95092918 AGGCAGAAACAAAAGGATGATGG + Intergenic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1131838465 15:96413105-96413127 AGTGAGAATCAGAGAGATGCAGG - Intergenic
1131871616 15:96769905-96769927 AGGAAGAAGCACAGACATGAAGG - Intergenic
1131937934 15:97527562-97527584 AGGGAGAAAGAGAAAGATTCGGG + Intergenic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133392770 16:5422830-5422852 AGGGAGGAGCAGAGAGAAGGAGG + Intergenic
1133487143 16:6231300-6231322 AGGGATATGTTGAAAGATGAAGG + Intronic
1133513020 16:6479296-6479318 AGAGAGAGCCAGAAAGATCAGGG + Intronic
1133589562 16:7229604-7229626 AGGAAGGAGAAGAAAGATGGAGG + Intronic
1134474914 16:14564811-14564833 TGAGAGAAGCAGAAAGCAGATGG - Intronic
1134782561 16:16911588-16911610 AGCCAGAGGCAGAAAGAAGATGG - Intergenic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135159640 16:20082459-20082481 AGGGAGAATAAGAAAGGAGAAGG + Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135495022 16:22943821-22943843 AGGGGGATACAGAAGGATGAGGG + Intergenic
1135523847 16:23198388-23198410 AGGGAGAGGCAGATAGATACTGG - Intronic
1135604843 16:23814568-23814590 AGGGACAAGGAGATAGAGGAAGG - Intergenic
1135784151 16:25333154-25333176 ATGGGGAAGGAGACAGATGAAGG + Intergenic
1135842215 16:25887170-25887192 AAGGAGTAACAGAAAGCTGATGG + Intronic
1135858239 16:26031678-26031700 AGGGCCCAGCAGAAAGATGGAGG + Intronic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1136491884 16:30613936-30613958 AGGAAGGAGAAGAAAGAAGAAGG + Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1136556883 16:31012116-31012138 ACGGAGGTGCAGAAAGATGCAGG - Intergenic
1137735206 16:50718789-50718811 AGCGAGTGGCTGAAAGATGATGG + Intronic
1137914376 16:52412919-52412941 AGGGAAAAGCAGAAACATTAGGG + Intergenic
1137930123 16:52579010-52579032 AGGAAGGAGCAGAAAGGAGAGGG + Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138062500 16:53906723-53906745 TGGTAGAAGCAGGAAGATGCAGG + Intronic
1138211540 16:55167235-55167257 TGGGAGAAGTAGACAGATCATGG + Intergenic
1138529033 16:57625125-57625147 TGGGGAAAGCAGAAAGCTGAAGG - Intronic
1138931970 16:61669826-61669848 TGGGAGGTGCAGAGAGATGAAGG - Intronic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139208689 16:65054765-65054787 AGGTAGAAGCCTAGAGATGAAGG - Intronic
1139640874 16:68290608-68290630 AGGGAGGAGGAGAAGGATGAGGG - Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139813826 16:69649406-69649428 AAGTAGAAGCAGAAAAATGAAGG - Intronic
1140197877 16:72870471-72870493 AGGCAGAGGCAGACAGATCACGG + Intronic
1140565040 16:76031907-76031929 AGAGAGAACCAAAGAGATGATGG + Intergenic
1140644607 16:77015796-77015818 GGGGAGAAGGAGAAAGACCAAGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141272159 16:82551150-82551172 AGTGAGCAGCCGAAAAATGATGG - Intergenic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1141711412 16:85701386-85701408 AAGAAGAAGGAAAAAGATGAAGG - Intronic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141801261 16:86310996-86311018 AGGAAGGACCAGGAAGATGAAGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141941584 16:87279415-87279437 ACGCAGAAGCACACAGATGATGG + Intronic
1142292646 16:89200044-89200066 AGGGACAAGCAGAAAACTTAGGG - Intronic
1142728126 17:1831156-1831178 TGGAATAAGCAGACAGATGACGG - Intronic
1142943199 17:3400684-3400706 TGGGACAAACAGAAAGAAGAAGG + Intergenic
1143384355 17:6518740-6518762 AGAGAGAAAGAGAAAGATGGAGG + Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143395409 17:6590998-6591020 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
1143563880 17:7709930-7709952 AGTGAGAGGCAGAAAGAAGGCGG - Exonic
1143656944 17:8300443-8300465 AGGAAGAAGAAGAAAGAAGAAGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144152333 17:12461514-12461536 GGGGAGAGGCAGGAAGAGGATGG + Intergenic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1145285348 17:21501810-21501832 AGGGGGTAGCAGAGAGATGGCGG - Intergenic
1145392171 17:22463930-22463952 AGGGGGTAGCAGAGAGATGTTGG + Intergenic
1145797191 17:27662560-27662582 AGGGAGCCGCAGAAGGATGGTGG - Intergenic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1147228231 17:38997662-38997684 AGGGAGAAAGAGAGAGAGGAAGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147566828 17:41541609-41541631 TGGGAGAGGCACAAAGATGGAGG + Intergenic
1148386770 17:47239801-47239823 AGGGTGAGGCAGACAGAGGATGG + Intergenic
1148389771 17:47263057-47263079 AGAGAGCACCAGAGAGATGAAGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149020235 17:51955195-51955217 TTCGAGATGCAGAAAGATGAAGG - Intronic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149115889 17:53096415-53096437 AGAAAGAAGAAGAAAGATGAAGG + Intergenic
1149302181 17:55315659-55315681 AAGGAGAAGCAGTAAAATGTTGG + Intronic
1149911937 17:60574674-60574696 GGGGAGAAGAAAAAAGATGATGG - Intronic
1149999621 17:61425646-61425668 AGGAAGCAGCAGAGAGCTGAGGG - Intergenic
1150006680 17:61474119-61474141 GGGGAGGATCAGAAGGATGATGG + Intronic
1150368305 17:64611609-64611631 AGAGAGAAGTAGACAGATGAAGG - Intronic
1150478093 17:65489032-65489054 AGGGAGAGGAAGAGAGAGGAAGG + Intergenic
1150788967 17:68184717-68184739 AGGAAGTGGCACAAAGATGAGGG + Intergenic
1151410754 17:73926619-73926641 GAGGAGAAGGAGAGAGATGAGGG - Intergenic
1151673904 17:75588433-75588455 AGGAGGAAGCGGAAAGATAAGGG + Intergenic
1151799070 17:76366839-76366861 AGAGAGAAAGAGAAAAATGAGGG - Intronic
1151815876 17:76471167-76471189 AGGTAGGAGGAGAAAGAGGAAGG + Exonic
1152400806 17:80065152-80065174 AGGGAGGAGGGGGAAGATGAAGG - Intronic
1152400820 17:80065191-80065213 AGGGAGGAGGGGGAAGATGAAGG - Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153230261 18:2928244-2928266 GGGAAGAAGCAGCAAGAAGAAGG - Intronic
1153384972 18:4482608-4482630 TGGGAAAAGCAGAATGATGCAGG + Intergenic
1153510387 18:5845634-5845656 AGGAAGTATCTGAAAGATGATGG - Intergenic
1153566418 18:6422729-6422751 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1153569895 18:6459700-6459722 AAGGAGAAGAAGAGAGATGGAGG - Intergenic
1153861805 18:9218533-9218555 TGGGAAAAGCAGAAATATAACGG + Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154009314 18:10561660-10561682 AGAGAGAGGCAGACAAATGAGGG - Intergenic
1154213012 18:12396026-12396048 AGAGAGGTCCAGAAAGATGAGGG + Intergenic
1154496907 18:14968098-14968120 TAGGAGAAACAGGAAGATGATGG - Intergenic
1155354980 18:24943287-24943309 AGGGAGGAAAAGAAAGAGGAAGG + Intergenic
1155583433 18:27338408-27338430 AGGGTGAGGCAGAAGGATCACGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155698559 18:28714698-28714720 AGGTAGAAACAGGAAGATAATGG + Intergenic
1155868327 18:30994242-30994264 AGTGAAAAGCAGGAAGAAGATGG - Exonic
1156315458 18:35965129-35965151 AAGGAGAAGGAGAAAAAAGAAGG - Intergenic
1156330179 18:36114168-36114190 CGGGAGGAGCTGAAAGATGCCGG - Exonic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1157382016 18:47227142-47227164 AGGAAGAAGGAGGAAGATGGAGG - Intronic
1158156819 18:54435279-54435301 AGTGAGAAGCATAAAAATGAAGG - Intergenic
1158186713 18:54779913-54779935 AGGGAGAAGCAGTCAGGAGACGG - Intronic
1158374647 18:56849094-56849116 AGAGATAAGGAGATAGATGAAGG - Intronic
1158495885 18:57954854-57954876 AGGGAGAAGCTGAGCTATGAAGG + Intergenic
1158669935 18:59465327-59465349 AGAGAGAAGAAGAAAGAGAAAGG - Intronic
1158830613 18:61273797-61273819 AGGAAGAAGGATAAAGATCAAGG + Intergenic
1158985126 18:62807423-62807445 GGGGAGAAGCATAAAGAAGAAGG + Intronic
1159175627 18:64829840-64829862 AGGGAGAGGTAGAGAGATGGGGG + Intergenic
1159230616 18:65603905-65603927 AGGTAGAAGCAGTAATAGGAAGG - Intergenic
1159260682 18:66008037-66008059 AAGGAGAAGAACAAAGTTGAGGG - Intergenic
1159360830 18:67400425-67400447 AGGTAGCAGCAGGATGATGAGGG - Intergenic
1159600824 18:70427196-70427218 AGGAAGAAGCAGATAAAGGAAGG - Intergenic
1159695521 18:71552405-71552427 AGAAGGAAACAGAAAGATGATGG + Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159889113 18:73938094-73938116 AGGGAACAGGAGAAGGATGAAGG + Intergenic
1160133473 18:76250729-76250751 AGGAAGAAGATGAGAGATGAAGG + Intergenic
1160610382 18:80080012-80080034 AGTGAGCAGCAGAGAGATGGTGG + Intronic
1160701824 19:511237-511259 AGGGAGGAGGAGGAAGAGGAAGG - Intronic
1160867591 19:1262620-1262642 AGTGAGAACCAGAAAGAGGGTGG - Intronic
1160925352 19:1542229-1542251 AGGGAGAAGAAGGAAGAAGAAGG - Intergenic
1161166289 19:2789574-2789596 TGGAAGAAGCAGACAGAAGAAGG + Intronic
1161170748 19:2811474-2811496 AGGGAGAAGCTGGAGGATCACGG - Intronic
1161918733 19:7250327-7250349 AGAGAGAAAAAGAAAGAGGAGGG + Intronic
1161918737 19:7250346-7250368 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1161934343 19:7362297-7362319 AAGGAGAAGGAGGAAGAAGAAGG + Intronic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1162470608 19:10870618-10870640 AGGGGGATGCAGAGAGAAGACGG + Intergenic
1162705987 19:12555272-12555294 AGAGAGAAAGAGAAAGAAGAAGG + Intronic
1163124154 19:15235458-15235480 TGGGAGAAGCGGGGAGATGAGGG - Intergenic
1163260805 19:16188759-16188781 AGGGAGAATCAGCCAGGTGAGGG + Intronic
1163387239 19:17007372-17007394 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163712028 19:18852646-18852668 AGGGAGGGACAGAAAGAGGAGGG - Intronic
1163712036 19:18852670-18852692 AGGGAGGGACAGAAAGAGGAGGG - Intronic
1163779788 19:19240173-19240195 AGGGAGAAGGAGAGAGATGAGGG - Intronic
1163884648 19:19955107-19955129 AAGGAGAAGGGGAAAGAAGAAGG + Intergenic
1164011864 19:21210591-21210613 AGGTGGCAGCACAAAGATGATGG + Intergenic
1164061368 19:21678226-21678248 AGGTGGCAGCATAAAGATGATGG - Intergenic
1164493087 19:28732142-28732164 AAGGAGAAGGAGAAAGAAGGAGG + Intergenic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1164940153 19:32245980-32246002 GGGGAGAGGGAGAGAGATGAAGG - Intergenic
1165100542 19:33436135-33436157 AGGGAGGAGAAGGAAGATGGAGG + Intronic
1165106874 19:33475502-33475524 AGCAAGCAGCAGAAAGTTGATGG - Intronic
1165331734 19:35144105-35144127 AGAGAGAAGCAGAGAGACGGAGG + Intronic
1165370192 19:35400569-35400591 AGAGAGAGACAGAAAGAAGAAGG + Intergenic
1165387513 19:35519510-35519532 AGGGAGAAACACAGAGAGGAAGG - Intergenic
1165468752 19:35990732-35990754 AGGGAAAAGAAGGAAGAAGAAGG + Intergenic
1165468777 19:35990869-35990891 AGGAAGAAGGAGGAAGAAGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166962179 19:46504152-46504174 AGAGAGGAGCAGAAAGACAACGG - Intronic
1166978727 19:46620569-46620591 ATGGAGAAGCTGGCAGATGAAGG - Exonic
1167073696 19:47235999-47236021 AGGAAGAAGAAAAAAGAAGAAGG - Intergenic
1167189860 19:47977858-47977880 AGGGAGAGAAAGAGAGATGACGG - Intronic
1167794056 19:51697660-51697682 AGGGAGCAGCAGGGAGATGGAGG + Intergenic
1168519863 19:57040939-57040961 AGGGAGAAGTAAGAGGATGAGGG + Intergenic
1168657670 19:58142826-58142848 AGGGAGAAGGAGAAAGGGGTTGG - Intronic
1168659687 19:58155884-58155906 AGGGAGAAAGAGAGAGAGGAAGG + Intergenic
925078154 2:1037161-1037183 AGAGAGAAGCAGAAGGCAGATGG - Intronic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925536041 2:4917777-4917799 AGGGAGAAGGAGAAACAGAAAGG - Intergenic
925653849 2:6123585-6123607 AGGGAAAGGAAGAAAGATGAGGG - Intergenic
925761518 2:7188868-7188890 AGGGAGAATGAAAAAGATCAAGG + Intergenic
925820449 2:7794595-7794617 GGGGAGAGGGAGAAAGAGGAAGG + Intergenic
926266880 2:11331001-11331023 AGGAAGGAGCAGAAAGAAGGAGG + Intronic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
928096163 2:28406479-28406501 ACGGAGACCCAGAAAGGTGAAGG + Intronic
928607559 2:32957453-32957475 AGGGAAAGGGAGAGAGATGAGGG + Intronic
928708628 2:33979618-33979640 AGAGAGAAGCACAAATATCAAGG + Intergenic
928885558 2:36144037-36144059 AGGAAACAGAAGAAAGATGATGG - Intergenic
928908951 2:36399245-36399267 AGACAGAATCAGAAAGAAGATGG + Intronic
929080071 2:38113671-38113693 AGGGAGAACCAAAGAGGTGAGGG + Intergenic
929144456 2:38694493-38694515 AGGGAGAGAGAGAAAGAGGAAGG + Intronic
929428310 2:41866233-41866255 GGGAAGAAGGAGATAGATGAAGG - Intergenic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
929772718 2:44905987-44906009 AAGAAGAGGCAGAAAAATGAAGG - Intergenic
929828520 2:45329153-45329175 AGGGAAAGGGAGAAAGAAGAGGG + Intergenic
929931348 2:46258509-46258531 AGAGAGAAGGAGGAAGAGGAGGG + Intergenic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
929998653 2:46846417-46846439 AGGGAGAAGCAGGCATAAGAGGG + Intronic
930331553 2:49991794-49991816 AAGGAGAAGAACAAAGTTGAAGG + Intronic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
931010924 2:57912485-57912507 AGGGAGGAGCACAAATATAAGGG + Intronic
931142836 2:59482549-59482571 ATGGAGAAGAGGAAAGATTATGG + Intergenic
931483678 2:62669056-62669078 AGGCAGAAGCAGAAGAAAGACGG - Intergenic
931868012 2:66432704-66432726 AGGGAGAAACAGAGAGAAAAAGG + Intergenic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
931942045 2:67262915-67262937 AGGGAGAAACAGAGAGGTAATGG - Intergenic
932085669 2:68756463-68756485 AGGGAAAAGGAGAAAAATGAAGG - Intronic
932454732 2:71842110-71842132 AGAGAGAAACAGCAAGATCAAGG - Intergenic
932463673 2:71899223-71899245 AGGGAGAAGCAGATACATCCAGG + Intergenic
932772170 2:74506622-74506644 AGGCAGAAGGCCAAAGATGAGGG - Intronic
932836210 2:75040338-75040360 GGAGAGAAGCAGAAATATTATGG - Intergenic
933167366 2:79091255-79091277 AGGGAACAGCAGATAGAAGATGG - Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933493009 2:83012342-83012364 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
933625618 2:84595089-84595111 AGGGAGCAGAAGAAAAATGATGG + Intronic
933855709 2:86412257-86412279 AGGGAGAAGAAGGAAGAAGGAGG - Intergenic
934040773 2:88126031-88126053 TGGGAGAAGCAGAGAGACAAAGG - Intronic
934535321 2:95128600-95128622 AGGGAGAAGAAGAAAGAAAAAGG + Intronic
934535326 2:95128629-95128651 AGGGAGAAGAAGAAAGAAAAAGG + Intronic
934535339 2:95128700-95128722 AGGAAGAAGGAGAAAGAAGGAGG + Intronic
934652389 2:96099942-96099964 GGTGAGAAGGAGAAAGAGGAAGG + Intergenic
934982280 2:98852927-98852949 AGGGAAAAGGAGAGAGAAGAAGG + Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935178613 2:100670876-100670898 AGGGAGGAGAAGAAAGGTGCAGG - Intergenic
935435829 2:103031118-103031140 AGGGAGAAATAGAAAGTTCAAGG - Intergenic
935701620 2:105817200-105817222 AATGAGATGCAGACAGATGAAGG + Intronic
935898953 2:107769966-107769988 AGGGAGTAGCAGAAATTTCAAGG - Intergenic
936590342 2:113797749-113797771 AGGGAAAAGAAGAAACATAATGG - Intergenic
936644619 2:114354724-114354746 AGGGAGCTACAGAAAGAGGAGGG + Intergenic
936731294 2:115384457-115384479 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
936916393 2:117643153-117643175 AAGGAGAATCGGAAAGATAATGG + Intergenic
937169583 2:119852196-119852218 AAGGAGAAGCGGAAAAAAGAAGG - Intronic
937327125 2:120996723-120996745 ACGAAGAAGAAGAAAGAAGAAGG - Intergenic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
937563277 2:123251431-123251453 AAGGAGAAGAAGAAAGATGGCGG + Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938810190 2:134845756-134845778 AGGAAAAAGCAAAAAGAAGAAGG + Intronic
938954029 2:136282188-136282210 GGGAAGAAGGAGGAAGATGAAGG + Intergenic
939123919 2:138152304-138152326 AGGGGGAAGAAGAAAGAAGAAGG - Intergenic
939652357 2:144779560-144779582 AGAGAGAAAGAGAGAGATGAGGG - Intergenic
939691371 2:145265953-145265975 AGGCAGAAGCAGAATGATCTGGG + Intergenic
939718025 2:145609943-145609965 AGGCAAATGCAGGAAGATGAGGG + Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940184816 2:150972203-150972225 AGGGAGAGGAAGAGAGATGAGGG + Intergenic
940251192 2:151678761-151678783 ACTGAGAAGCAGAGACATGAGGG + Intronic
940253730 2:151707594-151707616 TGGCAGAAGCAGCAAGTTGAGGG + Intronic
940312542 2:152293751-152293773 AGGCAGGAGCATAATGATGAAGG - Intergenic
940412114 2:153377167-153377189 GGGGAGAGGCAGCAAGAGGATGG + Intergenic
940982949 2:160023842-160023864 AGGGAGTAGCAGAAACAACACGG + Intronic
941533988 2:166700693-166700715 TGCGAGAGGCAGAAAGATGAAGG - Intergenic
941601377 2:167547300-167547322 AGTGGGAAGCAGAAAGATTTTGG + Intergenic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942283620 2:174391635-174391657 GGGGAGAAGGAGAAAAACGATGG + Intronic
942507366 2:176657125-176657147 AGGAAGAAGAAGAAAGAAGTGGG + Intergenic
942659354 2:178247669-178247691 AGGGAAAGGCCCAAAGATGAGGG - Intronic
942950660 2:181717445-181717467 GGGGAGAATTAGAAAGAAGAGGG - Intergenic
942978213 2:182044958-182044980 ATAGAGAGACAGAAAGATGAAGG - Intronic
942991840 2:182211455-182211477 AAGGAGAAGCACAAAGTTGGAGG - Intronic
943214707 2:185015665-185015687 AGGGACAAGAAGAAAGATGCTGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943538809 2:189185466-189185488 AGAAAGAAGCAGAAAGATTCAGG + Intergenic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944269487 2:197765176-197765198 AGGGAGAAGGAGTAGGAAGAGGG + Intronic
944331288 2:198469378-198469400 AGGGAGCAAGAGAAAGAAGAGGG + Intronic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944526833 2:200627903-200627925 AGGGAGAATCAGAGAGAGAAAGG - Intronic
944534878 2:200698880-200698902 TGGGAGAATGAGAAGGATGAAGG + Intergenic
944565024 2:200981235-200981257 AAAGGTAAGCAGAAAGATGAGGG + Exonic
944623128 2:201539694-201539716 AAGGAGAGGAAGAAAGATGGGGG - Intronic
945284241 2:208066132-208066154 AGGGAGAAGCAGAAAAAGCCAGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG + Exonic
946017332 2:216614528-216614550 AGGAAGGAGGAGAAAGAAGAAGG - Intergenic
946141778 2:217697363-217697385 AGGGAGAAGAAAAGAGAAGATGG - Intronic
946149709 2:217756066-217756088 ATGCAGAGGCAGAAAAATGAGGG - Exonic
946352550 2:219164884-219164906 AGGGAGAGGCAGACAGTTGAAGG - Intronic
946490317 2:220143230-220143252 AGTGAGAAGGCAAAAGATGATGG - Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946540410 2:220678100-220678122 AGAGAGAAGCTGCTAGATGATGG - Intergenic
946863974 2:224026092-224026114 TGGCGGAAGCAGAAAGATCATGG - Intronic
946868396 2:224063347-224063369 AGGGAGACGGAGAAAGAGAAGGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947356342 2:229299951-229299973 AAAGAGTAGGAGAAAGATGAAGG - Intergenic
947361002 2:229345341-229345363 AGAGAGCAGAAGCAAGATGAAGG - Intergenic
947554015 2:231073094-231073116 AAGGAGAAGGAGAGAGATGGGGG + Intronic
947760530 2:232600489-232600511 AGGGGGCTGCAGAAGGATGATGG - Intergenic
948237783 2:236403318-236403340 AGAGAGAGGCAGAGAGAAGAGGG + Intronic
948617010 2:239205662-239205684 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169046820 20:2539864-2539886 AGTGAGAAGAAGAAAGAGGTTGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169525989 20:6426259-6426281 AGAGAGAAGAAGAAAGAGAAGGG - Intergenic
1169748250 20:8964736-8964758 AGGGAGAAACAGAGGAATGAAGG + Intronic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1170459676 20:16565603-16565625 AGGGTAAAGCAGAAAGAGAAAGG - Intronic
1170589001 20:17757023-17757045 AGGGAGAAGCAGAAAGATACGGG - Intergenic
1170682808 20:18541586-18541608 AAGGAGGAGGAGAGAGATGAGGG + Intronic
1170973598 20:21140121-21140143 AGGAAGAAGCAGAAAGAAATGGG - Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171991765 20:31702274-31702296 AGGGAGAGACAGAATGATGGAGG + Intronic
1172172401 20:32946286-32946308 AGGGAGAAGCTGGAAGCTGGTGG + Intronic
1172254063 20:33501478-33501500 AGGGAAATGCAGAATGGTGAGGG + Intronic
1172580828 20:36046549-36046571 AGGGAGAAGAGGAAGGGTGAAGG - Intergenic
1172606917 20:36220231-36220253 AGGGAGGAGAAGACAGATGCGGG + Intronic
1172643391 20:36455251-36455273 AGGGAGAAGCAGAGAACTGAGGG - Intronic
1173253538 20:41377043-41377065 AGAGAGAGGGAGAAAGATGGCGG + Intergenic
1173304403 20:41834711-41834733 AGGGAGGATCAGAATGGTGAGGG + Intergenic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1173767750 20:45629642-45629664 AGGGGCAAGCAAAAAGAGGAAGG + Exonic
1174572666 20:51513553-51513575 AGGGAGAAGCACAAACTTCAGGG + Intronic
1174591401 20:51648079-51648101 AGTGTGAAGCAGAAAGATTTAGG - Intronic
1174620873 20:51873646-51873668 AGGCAGATTAAGAAAGATGAAGG - Intergenic
1174763529 20:53229947-53229969 AGGAAGAAAGAGAAAGAAGAAGG + Intronic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1175306813 20:57981854-57981876 AGGGAGGACCAGAAAGAAGGGGG + Intergenic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175633043 20:60558077-60558099 AGGGAGAGGAAGAAAGAGCAAGG - Intergenic
1175683140 20:61005948-61005970 GGGGAGAAGCAGAACCATTAGGG + Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176672195 21:9745121-9745143 AGGGAGAAGGAGGAAGATAGAGG + Intergenic
1176735845 21:10546346-10546368 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1176843278 21:13857464-13857486 AGGGAGTAGCAGACAGAGGTCGG - Intergenic
1176968338 21:15236988-15237010 AGACAGAAGCAGAAATATGTGGG + Intergenic
1177072970 21:16534153-16534175 AAGGAAAAGGAGACAGATGAAGG + Intergenic
1177504812 21:22006678-22006700 AGGGAAAAACAGAAAGAAGGAGG + Intergenic
1177687862 21:24463387-24463409 AAAGAGAAACAGAAATATGATGG - Intergenic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1178643204 21:34363351-34363373 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643205 21:34363361-34363383 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643206 21:34363371-34363393 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178666031 21:34547317-34547339 AGGGAGGGGGAGAAAGGTGAGGG - Intronic
1179081847 21:38178699-38178721 AGAAAGAAGAAGAAAGAAGAAGG + Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179116671 21:38499705-38499727 GAGGAGAAGGAGAAAGATAAGGG + Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180155854 21:45977216-45977238 AGGGAGAGGAAGAAGGATGGAGG - Intergenic
1181030462 22:20146977-20146999 AGAGAGAAGCAGAAAGGTGGAGG - Intronic
1181085961 22:20439459-20439481 TGGGGGAAGGAGAAAGGTGATGG - Intronic
1181520328 22:23444838-23444860 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1181885262 22:26017068-26017090 AGGGAGAGGCACAGAGAGGAAGG - Intronic
1182158992 22:28103165-28103187 AGGCAGAAGCAGAGAGAAGCTGG - Intronic
1182975285 22:34618350-34618372 GGAGAGAAGCAGAAAAAAGATGG - Intergenic
1182977540 22:34637417-34637439 AGGTAGAAGCAGATAGCTGATGG - Intergenic
1183401514 22:37607886-37607908 AGGGAGAAAAAGTAGGATGAAGG - Intergenic
1183533306 22:38376524-38376546 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1183680407 22:39325417-39325439 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184110698 22:42392454-42392476 AGAGAGAAACAGAAAGGAGAGGG + Intronic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184310974 22:43642467-43642489 GGGGAGGAGCTGGAAGATGAGGG - Intronic
1184345971 22:43913229-43913251 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184604903 22:45567029-45567051 AGGGAGGCACAGAAAGGTGAAGG + Intronic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184952454 22:47853645-47853667 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1185207883 22:49550590-49550612 AGGGAGACGCAGAAAGCTTGGGG - Intronic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949199151 3:1351728-1351750 AGGAAGAAGTAGAAAGAATAAGG - Intronic
949204642 3:1423501-1423523 AGGGAGAGGCAGACTGATGCAGG - Intergenic
949677044 3:6467393-6467415 AGGGAGGAAGAGAAGGATGAAGG + Intergenic
950233585 3:11297938-11297960 AGGAAGAAGCATAAACATTAAGG + Intronic
950398873 3:12755007-12755029 AGGGGGAAGGAGAGAGAGGAAGG - Intronic
950858180 3:16125016-16125038 AGGGGGAGGCAGAAATATGATGG + Intergenic
950980865 3:17303099-17303121 GGGGAGCAGCAGAAAGAAAAGGG - Intronic
951605779 3:24433427-24433449 AGGGAGAAGCCAAAAAATCAAGG + Intronic
951742732 3:25942050-25942072 AGAGAAAAGCAGAAAAAAGAAGG - Intergenic
952245947 3:31592840-31592862 GGGGAAAAGCAGAAAAATGAAGG + Intronic
952776030 3:37047494-37047516 AGGAAGAAGCAAGAACATGAAGG - Intronic
953137303 3:40192253-40192275 AGGGAGAATTAGAAAGGTGAGGG - Intronic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953290186 3:41652636-41652658 AGTGAAAAGCAGAAAGAGGTGGG + Intronic
953480353 3:43246273-43246295 AGGGAGCAACAGGAAGATGTGGG + Intergenic
953827402 3:46265769-46265791 AGGGAGAACGAGACAGAAGATGG - Exonic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
954392775 3:50276109-50276131 AGGGAGAATCCGAAAGAGGCGGG - Intronic
955307444 3:57848500-57848522 AGGAAGAAGAAGAAAGAAGAAGG - Intronic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955663582 3:61327186-61327208 GTGGAGAAGCAGAAAGCTGGTGG + Intergenic
955848165 3:63190678-63190700 AGAGAGAAGGAGAAAGAGGGAGG + Intergenic
956376503 3:68618927-68618949 ACAAAGCAGCAGAAAGATGAAGG - Intergenic
956554331 3:70501280-70501302 AGGGAGAAGGTGAAAGAACAAGG + Intergenic
956665430 3:71637601-71637623 AGGGAGAAAAAGAAGGATGTAGG + Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
956943548 3:74193755-74193777 AGGGATATGCACAAAGAAGAAGG + Intergenic
957444913 3:80303522-80303544 AGGAAGAAACAGAGAGATAATGG - Intergenic
957541128 3:81570462-81570484 AGGGAGAAGATGAAGGTTGATGG + Intronic
957562910 3:81846864-81846886 AGGGAGAAGTAGACATCTGAAGG + Intergenic
957569288 3:81925399-81925421 AGGGATAAACCAAAAGATGAAGG + Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957640781 3:82850403-82850425 AGGGATAAGAAGAAAGAAGAAGG - Intergenic
957867982 3:86049702-86049724 AGGGGGAAGGAGGAAGGTGAGGG + Intronic
958475641 3:94577517-94577539 AAGGAGAAGAACAAAGATGGAGG + Intergenic
958982036 3:100732709-100732731 AGGGAAGAACGGAAAGATGAAGG - Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959435850 3:106314379-106314401 AGGGAGCAGGAGAAGGGTGAAGG - Intergenic
959643644 3:108671533-108671555 AGAGGGAAGGAGGAAGATGATGG - Intronic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960270886 3:115673232-115673254 AGAGAGAAAGAGAAAGAGGAGGG + Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960744562 3:120872855-120872877 AGGCAGTAGGAGAAAGAAGAAGG + Intergenic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
961408573 3:126701703-126701725 AGAAAGAAGCAGAAAGCTGAAGG - Intergenic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961917093 3:130387710-130387732 AGGGAGAAACTGTAAGAGGATGG + Intronic
962082934 3:132159760-132159782 GGGAAGAAACAGAAAGATTAGGG + Intronic
962246398 3:133797929-133797951 AGGGAGAAGGGGAAGGGTGAAGG + Intronic
962256900 3:133877230-133877252 AGGGAGATGCAGAAAGGGAATGG + Intronic
962653375 3:137518136-137518158 AGAGGGAAGGAGAAAGATAAGGG - Intergenic
963229834 3:142898469-142898491 AGGGAGGAGCAGAGAGAGGGAGG - Intergenic
963794031 3:149613406-149613428 AAAGACAAGCAGCAAGATGAAGG + Intronic
964407806 3:156367716-156367738 AGGGAGAAGGGGAAAGAAAAGGG - Intronic
964619411 3:158706262-158706284 AGGGAGGATCAGAAAGCTGAGGG + Intronic
964649732 3:158996963-158996985 ATAGAGAAGCAGCAAGATAAAGG - Intronic
965518384 3:169646926-169646948 AGGAAGAAAATGAAAGATGAAGG + Intronic
965711734 3:171562693-171562715 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
965711735 3:171562703-171562725 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
965752816 3:171994298-171994320 AGAGAGAAGCAGAGAGAATAAGG + Intergenic
965781084 3:172286860-172286882 AGTGAGAAGAAGATAGATGCAGG + Intronic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
966114520 3:176445691-176445713 AGGGAAAAGTAAAAAGATGCTGG - Intergenic
966296920 3:178434603-178434625 AGGAACAAGCAGAAAATTGAAGG + Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966644729 3:182231671-182231693 AGGGAGAGGGAGAGAGATGGGGG + Intergenic
966685416 3:182688478-182688500 AGGAAGAAGTAGAAAAAAGAAGG + Intergenic
966941295 3:184749318-184749340 AGGGAGAGAAAGAAAGAAGAAGG + Intergenic
967090620 3:186131825-186131847 GGGTAGAAGCAGAAACATGGTGG + Intronic
967384893 3:188901676-188901698 TGGGAGAGGCAGAAAGCTGAGGG - Intergenic
967545148 3:190717055-190717077 AGGCAGAGGTAAAAAGATGATGG + Intergenic
967621134 3:191635246-191635268 AGGGACTAAAAGAAAGATGAGGG - Intergenic
967877255 3:194275804-194275826 AGGGGGAAGCGGAAAGACCATGG - Intergenic
968115794 3:196088678-196088700 AGCGACAAGCAGAAAGAACAGGG - Intergenic
968355865 3:198106219-198106241 AGGAAGAGGGAGAAAGATGGAGG - Intergenic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968623327 4:1614430-1614452 AGGGGGATGCAGAGACATGAGGG + Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
969163288 4:5280424-5280446 AGGGAGAGTCAGGAAGATGAGGG - Intronic
969314806 4:6375435-6375457 AGGCAGAGGCAGAAAGAGAATGG - Intronic
969495286 4:7522943-7522965 AGGGAGAAGGGGAAGGATGGGGG - Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970196251 4:13553101-13553123 AGAGAGAAACAGATAGATGGGGG - Intergenic
970368835 4:15387947-15387969 AGGGAGAAGAGGAGAGAAGATGG + Intronic
970447363 4:16135442-16135464 AGGGAGAAGTGCAAAGATGCAGG + Intergenic
970477712 4:16440573-16440595 TGGGAGAAGCAGAAATATTTGGG + Intergenic
970765824 4:19547757-19547779 AGGCATAAGTAGAAAGAAGATGG + Intergenic
970833737 4:20374583-20374605 AGGGATAAGAAGAAAGTTGAAGG - Intronic
971017763 4:22506143-22506165 GGGGAGAAGCAGGAAGGTGCTGG + Intronic
971090622 4:23340535-23340557 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
972263252 4:37433086-37433108 AGGGAGAAGAAGAAAAATCAAGG - Intronic
972457911 4:39272388-39272410 GGAGAGAAGCAGACAGATGTGGG - Intronic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972866631 4:43241263-43241285 ATGCAGAAGCAGCCAGATGATGG - Intergenic
973136644 4:46716356-46716378 AAGGGGAAGCAGGAACATGATGG + Intergenic
973189740 4:47373244-47373266 TGGAAGAAGCAGAAAGAAAAAGG - Intronic
973209949 4:47604672-47604694 AGGGAGAAACAGTAAGATGTGGG - Intronic
973255108 4:48102993-48103015 AGAGAGGACCAAAAAGATGAAGG + Intronic
973607242 4:52600032-52600054 AGGAATAAGCAGGGAGATGAGGG - Intronic
973796678 4:54434332-54434354 AGTGAGAGGCACAAACATGAAGG - Intergenic
973962683 4:56127522-56127544 AGGCAGAAGAAGAGAGAAGAAGG - Intergenic
974072096 4:57133192-57133214 AGGAAGAAGCTAAAAGATGCTGG + Intergenic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974453511 4:62096218-62096240 AGGAAGAAGAAGAAAGATAAAGG - Intergenic
975112312 4:70641828-70641850 AGAGAGAACCAGAAAGAGTATGG + Intronic
975338264 4:73206687-73206709 AGGGTGGACCAGAAAGATGTTGG + Intronic
975480103 4:74868800-74868822 AGCCAGAAGCAGAAACATAAAGG + Intergenic
975631437 4:76407815-76407837 AGAGAAAAGAAGAAAGAGGAAGG + Intronic
975986443 4:80204968-80204990 AGGGAAGAGTAGAAAGAGGAGGG - Intergenic
976249490 4:83035452-83035474 TGGGAGAAGCAGAAAGCTGGAGG + Intronic
976519200 4:86006752-86006774 GGGGATAAGCAAATAGATGAAGG - Intergenic
976848986 4:89523515-89523537 ACTGAAATGCAGAAAGATGAAGG + Intergenic
977649749 4:99455443-99455465 AGGGAGATGAAGAAAGACAAAGG - Intergenic
977851674 4:101837925-101837947 AGGGAGAGGGAGAGAGAAGAGGG - Intronic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
978169875 4:105656986-105657008 AGGTACAGGCAGATAGATGATGG + Intronic
978193067 4:105938468-105938490 AGGGAGAAAGTGAAAGGTGATGG + Intronic
978264777 4:106810417-106810439 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
979337563 4:119480777-119480799 AGAGAGAAGCAAAAACATGAAGG - Intergenic
979491071 4:121328458-121328480 AGGGAGAAGCAGCCAAGTGACGG - Intergenic
979507751 4:121517187-121517209 AGGGAGGAGGAGAAAAATCAGGG - Intergenic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
979957107 4:126967923-126967945 AGGAAGAAAAAGAAAGCTGAGGG + Intergenic
980318347 4:131235403-131235425 ATGGTGAACCAAAAAGATGATGG + Intergenic
980532374 4:134072164-134072186 AGGGAGAAAAAGGAAGCTGAAGG - Intergenic
980649553 4:135694817-135694839 AAGATGATGCAGAAAGATGATGG - Intergenic
981191394 4:141868981-141869003 AAGGAGAGGGAGAGAGATGAGGG + Intergenic
981616090 4:146646488-146646510 AGGGAGAGGAAGAGAGAGGAGGG - Intergenic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981673187 4:147311156-147311178 GGAGAGAAACAGAAAGAGGAGGG + Intergenic
981695949 4:147558906-147558928 AGAGAGAAGGAGAAAGATTGAGG + Intergenic
981783215 4:148448364-148448386 AGGGAGAGTCAGAAAGAGAAAGG + Intergenic
981924494 4:150123360-150123382 AAGGAGAGGGAGAGAGATGAGGG + Intronic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983662833 4:170147633-170147655 AGAGAGAGAGAGAAAGATGATGG - Intergenic
984318284 4:178157458-178157480 AGGAACAAGGTGAAAGATGAGGG + Intergenic
985402540 4:189606727-189606749 AGGGAGAAGGAGGAAGATGGAGG - Intergenic
985987592 5:3529689-3529711 AGGGAGAAGGAGAGAAAAGAGGG - Intergenic
986206399 5:5628820-5628842 AGGGAGGAAGAGAAAGCTGAGGG - Intergenic
986566769 5:9123467-9123489 AAGGAGAAGGAGAAGAATGATGG + Intronic
986649077 5:9946252-9946274 AGAGAGAGCCAGAAAGATGCGGG - Intergenic
986875228 5:12099127-12099149 AGGGAGAGGGGGAAAGCTGAGGG + Intergenic
986896486 5:12376842-12376864 AGGGTGCAGCAGAAAAATAATGG + Intergenic
986916970 5:12632522-12632544 AAAGAGAAGCAAAAAAATGAAGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987263461 5:16227280-16227302 AGGGAAATGCAGTAAGATCATGG + Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987678358 5:21104775-21104797 ATAGAGGAGCAGGAAGATGAAGG + Intergenic
988000914 5:25347167-25347189 AGGAAGAAAGAGAATGATGAAGG - Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988089626 5:26519794-26519816 AAGGAGAAGGAAAAAGAAGAAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988237046 5:28559507-28559529 AGGGAGAAAGAGAAAGATGGGGG - Intergenic
988452622 5:31358670-31358692 AGGAAGAAAGAGAAAGAAGATGG - Intergenic
988632089 5:32942416-32942438 AGGAAGAAGAAGAAAGAAGAAGG + Intergenic
988985122 5:36610858-36610880 AGGCAGAAGCAGCAAGAAGAAGG + Intronic
989465718 5:41752871-41752893 AAGGAGAAAGAGAAAGATTAGGG - Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989652106 5:43702365-43702387 AGGGAGAAGCATAATAATGCAGG + Intronic
989683499 5:44057792-44057814 AAGGAGAAGGAGAAAGATCTTGG + Intergenic
990122034 5:52466782-52466804 AGAGAGAAAGAGAAAGAAGATGG - Intergenic
990143991 5:52738025-52738047 TGGGAGAAGAAGTAAGAAGAAGG - Intergenic
990636082 5:57728621-57728643 AGAGAGAAGAAGAAAGCTGGAGG - Intergenic
990821383 5:59844597-59844619 AGGAAGAACCAGATATATGAAGG - Intronic
990881588 5:60544882-60544904 AGGGAGGACTAGAAAGTTGAAGG - Intergenic
990895010 5:60689720-60689742 ATGTAGAAGCAGAAATATAACGG + Intronic
991003559 5:61806347-61806369 AGGGACAGGCAGAGAGATAAAGG + Intergenic
992121799 5:73601343-73601365 AAGGAGAAGAACAAAGTTGAAGG - Intergenic
992160589 5:73997083-73997105 AGTGATTAGAAGAAAGATGAAGG - Intergenic
992246866 5:74834895-74834917 AGCTGGAAGCAGAAAGAAGATGG - Intronic
992407470 5:76473444-76473466 AGAGAGAAGGAGAAAGAGGGAGG - Intronic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
992644276 5:78797637-78797659 CGGGGGCAGCAGAAAGGTGATGG - Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993292069 5:86086265-86086287 AAGGATAAGCATAAAGAAGAAGG + Intergenic
993330509 5:86594491-86594513 AGAGAGAAAAAGAAAGAGGAAGG + Intergenic
993373362 5:87119168-87119190 AGGGAGAAGAGGAAAGCGGAGGG + Intergenic
994464545 5:100109977-100109999 AGGAAGAAGGAGAAAAATAATGG - Intergenic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995256600 5:110053806-110053828 GGGGAAAATGAGAAAGATGATGG - Intergenic
995350818 5:111173364-111173386 AAGGAGAAATATAAAGATGAAGG + Intergenic
995380965 5:111532745-111532767 AGGCTGAAGCAGGAAGATGAAGG + Intergenic
995646698 5:114320734-114320756 ATGGAGAAGAAGATACATGAAGG - Intergenic
995737679 5:115319951-115319973 AGGGAGATGCACAAAGATTAAGG + Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996206768 5:120747741-120747763 AGGAAGGAAGAGAAAGATGAAGG + Intergenic
996590895 5:125146931-125146953 AGGGAGAAGCAGGGAGAAGCAGG - Intergenic
996598176 5:125229013-125229035 ATGGAGAGGCAGAAATATAATGG + Intergenic
996699590 5:126437007-126437029 AGGCAGAAGCAGTAGGATGGAGG + Intronic
996801994 5:127414641-127414663 AGGGAGAAGCAGATTAATGTGGG + Intronic
997240694 5:132304621-132304643 AAGAAGAAGAAGAAAGATCAGGG + Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997735126 5:136207626-136207648 AGCAGGAAGCAGAAAGGTGAAGG - Intergenic
997827937 5:137124311-137124333 GGGGAGAAGCACAGAGAAGAGGG - Intronic
997849114 5:137315051-137315073 AGGGGTAAGCAGACAGGTGAGGG - Intronic
997996402 5:138590243-138590265 AGTGAGAATCAGGAAGATGAAGG + Intergenic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998182106 5:139953045-139953067 AGAGAGAAGAAGAAAGAGCAAGG + Intronic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998410465 5:141906712-141906734 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999652105 5:153777778-153777800 AGGGAGAAAAAGAAATATTAGGG - Intronic
999795785 5:154988664-154988686 AGTGGGAAACAGAAAGAGGATGG - Intergenic
1000255870 5:159537722-159537744 AGAGGGAAGTAGAAAAATGAAGG - Intergenic
1000444177 5:161299617-161299639 AGGGAGAGAAAGAAAGAGGAAGG - Intronic
1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG + Intronic
1001426536 5:171626156-171626178 AAGAAGAAGAAGAAAGGTGAAGG - Intergenic
1001906192 5:175475644-175475666 TGGGAAAAGCAGATGGATGAAGG - Intergenic
1002135892 5:177107326-177107348 AGGGAGACACAGAAAGGTCATGG - Intergenic
1002137045 5:177114076-177114098 AGGGAGAAGCAGAGGGCTCATGG - Intergenic
1002401053 5:178991782-178991804 GGGCAGAAGCAGAAAGATGGGGG - Intronic
1002482212 5:179510095-179510117 AGGAAGAGGAAGAAAGAAGAAGG - Intergenic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1002815024 6:671560-671582 AGGGAGAAGCAAAATGATATAGG - Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003017314 6:2478489-2478511 AGGGAGAAAGAGAAAGATGAAGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003160416 6:3629690-3629712 AGAGAGAAGCACAAAGGAGAGGG - Intergenic
1003187743 6:3847902-3847924 AGGGACAGGAAGAGAGATGAAGG + Intergenic
1003709612 6:8574845-8574867 AGGGAGAAAGAGAAAGAGAAAGG - Intergenic
1003736078 6:8878964-8878986 AGGGAGAAGCAAAAGGAACACGG - Intergenic
1003746051 6:9003955-9003977 AGGGAGAGGGAGGAAGAGGAGGG - Intergenic
1003803544 6:9699785-9699807 ATGGAGTAGCAGAAAGACCACGG - Intronic
1003824319 6:9935940-9935962 AGTGAGAAGCAGGAGGATGCTGG - Intronic
1004073718 6:12326108-12326130 GGGAAGAAGGAGAAAGGTGAGGG + Intergenic
1004539844 6:16539483-16539505 AGAGAGGAGCAGAGAGATAAAGG + Intronic
1004563245 6:16771330-16771352 AAGGAGAATCAGAAAGACCAAGG - Intergenic
1004886390 6:20055049-20055071 AGAGAGAAGCAGCCACATGATGG + Intergenic
1005622012 6:27628876-27628898 TGGGGGAAGGAGAAAGAAGAGGG + Intergenic
1005716448 6:28553855-28553877 AGGAACAAGCAGAAAAATCATGG - Intergenic
1005721954 6:28611348-28611370 AGGGAAAAGAGGAAAGTTGAAGG - Intronic
1005914216 6:30338441-30338463 GAGGAGATGGAGAAAGATGAGGG + Intronic
1006089496 6:31620239-31620261 AGGGAGAAAGAGAGAGAGGACGG - Intergenic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006277588 6:33018049-33018071 AGAGTAAAGAAGAAAGATGAGGG - Intergenic
1006592448 6:35168530-35168552 GGGGGAAAGCAGAAAGATGCAGG - Intergenic
1006617746 6:35341380-35341402 AAAGAGAAGCAGAAAGAAGGGGG + Intergenic
1006709136 6:36050278-36050300 AGGGAGATGAAGACAGAAGAGGG + Intronic
1006743333 6:36324439-36324461 AGGGAGAAGGTGCAGGATGAGGG - Intronic
1007111280 6:39314583-39314605 AGGGAGAAGGAGGAAGCTGCTGG + Intergenic
1007234363 6:40379642-40379664 AGGGAAAAGAAGAGGGATGAAGG - Intergenic
1007452609 6:41951603-41951625 AGAGAGAAGCAGGAAGAAGAGGG + Intronic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1007946159 6:45828909-45828931 AGGAACAAACAGAAAAATGAAGG + Intergenic
1008123143 6:47640753-47640775 AGATAAAACCAGAAAGATGATGG - Intergenic
1008433791 6:51451512-51451534 AGGGAGTAGCAAACAGGTGAGGG + Intergenic
1009350257 6:62666781-62666803 AGAGAGACACAGAAAGAAGAAGG + Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009590935 6:65670088-65670110 AAGGAGAAACAGAAAGGTGCAGG - Intronic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1010471937 6:76238838-76238860 AGGAAGAAGAACAAAGCTGAAGG + Intergenic
1011152151 6:84286303-84286325 AGGGAGAGAGAGAAAGAGGAAGG - Intergenic
1011187007 6:84688757-84688779 AGGGATAAGCAGAACGGAGAAGG + Intronic
1011568121 6:88702265-88702287 AGGCAAAAGAACAAAGATGAAGG + Intronic
1011658805 6:89576507-89576529 AAGGAGTAGCAGAAAAGTGAAGG - Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1011949128 6:92942557-92942579 AGAGAGAAAAAGAAAGAGGAAGG - Intergenic
1011956022 6:93026364-93026386 GCTGAGAAGAAGAAAGATGAGGG - Intergenic
1012118296 6:95332930-95332952 AAAGAGAAGGAGTAAGATGAGGG + Intergenic
1012839990 6:104317961-104317983 AGGGAGAAGAAGGGAGATCATGG + Intergenic
1013172636 6:107650683-107650705 AAGGAGAAGGAGAAAGATGGGGG - Intronic
1013327788 6:109064693-109064715 AGAGAGAGGGAGAGAGATGAAGG + Intronic
1013490869 6:110645540-110645562 AAGTAGAAGTAGAAAGATAAAGG + Intronic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1013859078 6:114611998-114612020 AGGAAGAAAGAGAAAGAAGAAGG - Intergenic
1014139708 6:117927226-117927248 AGGAAGAAGCACAAGAATGAAGG + Intronic
1014215038 6:118745189-118745211 AGGGGGAAGGAGAAAAAAGATGG + Intergenic
1014429895 6:121356135-121356157 AGACTGAAGCAGGAAGATGAAGG + Intergenic
1015141066 6:129932382-129932404 AGAGAGAAAAAGAAAGAGGAGGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015559391 6:134498123-134498145 GGAGAGAAGAAGAAAGAGGAAGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016177079 6:141093549-141093571 AAAGAGAAGAACAAAGATGAAGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1017075674 6:150615525-150615547 CGGGAGATTTAGAAAGATGAAGG - Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017436249 6:154418272-154418294 AGAGAAAGGCAGAATGATGACGG - Intronic
1017675768 6:156812114-156812136 AGAGAGATGCAGAAATATCAAGG - Intronic
1017799568 6:157881347-157881369 AAGGAGAGGGAGAAAGACGAGGG - Intronic
1017805174 6:157939635-157939657 TGGGAGAAAGAGAAGGATGAGGG + Intronic
1017880077 6:158556482-158556504 AGGGAGGTATAGAAAGATGAAGG + Intronic
1018038080 6:159898665-159898687 AGGGAGGAGGAGGAAGAGGAAGG - Intergenic
1018097735 6:160406702-160406724 ACAGAGAGGCAGAAAGAAGAAGG - Intronic
1018514948 6:164569231-164569253 AGGGAAAAGGAGGTAGATGATGG - Intergenic
1018717206 6:166542711-166542733 AGTGACAGGGAGAAAGATGAGGG + Intronic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1018996602 6:168715028-168715050 GGGGAGAAGGAGGAGGATGATGG + Intergenic
1019263550 7:97607-97629 AAGGAGAGGGAGAAAGGTGAAGG + Intergenic
1019332363 7:466708-466730 AGAGTGAAGGAGAAAGGTGAAGG - Intergenic
1019332373 7:466760-466782 AGGGTGAAGGAGGAAGATGAGGG - Intergenic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019590914 7:1831390-1831412 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1019797661 7:3063691-3063713 AGAAAGAAGAAGAAAGAAGAAGG - Intergenic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1019964123 7:4484883-4484905 AGGGAGAGGGAGAAAGATTGGGG + Intergenic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1020251960 7:6476417-6476439 AGGGGGAAGAAGAAAGAACAGGG + Intronic
1020415465 7:7940961-7940983 AGGTAGAAGCAGAAGACTGAAGG - Intronic
1020446129 7:8269974-8269996 AAGGAGAAAAACAAAGATGAGGG + Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1020994475 7:15245484-15245506 AGGGAGGATCAGAAAAAGGAAGG - Intronic
1021450557 7:20779647-20779669 AGAGAGAAGGATAAAGATGTTGG + Intergenic
1021672661 7:23047525-23047547 AGGAGGAAGAAGAAAGAAGAAGG - Intergenic
1022043248 7:26601238-26601260 GGGGAGAAGAGGAAAGATAAGGG + Intergenic
1022134250 7:27432341-27432363 AGGGAGAGGCGGAAGGCTGAAGG - Intergenic
1022190756 7:28014868-28014890 AGGGAGTGGCATAAAGATGGTGG + Intronic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1022436333 7:30389384-30389406 TGGGAAAAGGAGAAATATGAAGG - Intronic
1022525838 7:31036627-31036649 AGAGAGAGACAGAGAGATGAAGG - Intergenic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1022873879 7:34507870-34507892 AGGGAGAAGGATAAAAGTGATGG - Intergenic
1023163196 7:37318019-37318041 ACTGAGGAGCAGAAAGATGGTGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1023836289 7:44069825-44069847 AGGGAGAAGGAGAGATAGGAGGG + Intergenic
1023986616 7:45100850-45100872 TGGCAGGAGCAGAAAGATGCAGG - Intronic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1024791138 7:52965988-52966010 AGAGAGAAAGAGAGAGATGAAGG - Intergenic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1025090902 7:56063694-56063716 AGGCAGAGGTAAAAAGATGATGG + Exonic
1025887791 7:65614601-65614623 AGGAAGAAGGAGGAAGAGGAAGG - Intergenic
1025969843 7:66312204-66312226 AGGCAGAAAGAGAAGGATGAGGG - Intronic
1026103104 7:67398847-67398869 AGGGAGAGGGAGTGAGATGAGGG + Intergenic
1026178299 7:68016867-68016889 AGGCAGTAACAGAAAGAGGAGGG + Intergenic
1026273239 7:68854490-68854512 AGGGAGAAGGAGAAACATATTGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026333832 7:69376978-69377000 AAAGAGATGCAGAAAGATGTAGG - Intergenic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1026837648 7:73649100-73649122 AGGGAGAGAGAGAAAGAGGAGGG - Intergenic
1026849701 7:73717181-73717203 GGGGAGAAGGAGAAAGAAGAGGG + Intronic
1026857257 7:73762921-73762943 AGAGAGAAAAAGAAAGATGGGGG - Intergenic
1027351164 7:77313031-77313053 AGGAAGAATGAGAAACATGAGGG - Intronic
1027476257 7:78635343-78635365 AGGAAATAGCAGAAAGCTGAGGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027821540 7:83051756-83051778 AAGAAGAAGAAGAAAGTTGAAGG + Intronic
1027831988 7:83188774-83188796 AGGGAGTAGCAGAAACAAGCTGG + Intergenic
1027953063 7:84843821-84843843 AGGGAGAAGCAGAAACAACATGG - Intergenic
1028302119 7:89213192-89213214 ACAGAGATGCAGAAAGATGATGG + Intronic
1028697200 7:93728271-93728293 TGGGAGAAGGAGCAAGTTGAAGG - Intronic
1028791689 7:94860554-94860576 AGGGAGCAGGAGAGAGATAAGGG + Intergenic
1028877696 7:95842071-95842093 AGGGAGAAACTGAGAGATGGAGG + Intronic
1029263679 7:99322280-99322302 AGGGGGAAGCAAAAAGAAGCAGG + Intergenic
1029449240 7:100631757-100631779 AGGAGGAAGCAGAGAGAGGAAGG - Intronic
1029455417 7:100668438-100668460 AGGGGGAAGAAGGAAGAAGATGG + Intergenic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030169641 7:106588509-106588531 ACTGAGAAGGAGAAAGATAATGG + Intergenic
1030182307 7:106722696-106722718 AGGGAAAAGAAGCAGGATGAGGG - Intergenic
1030324343 7:108203986-108204008 AGGGAGATGCAGAGAGGTGAAGG - Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031482750 7:122299121-122299143 AGGGAGAAGGAGAAAAGAGAGGG - Intergenic
1031649840 7:124275281-124275303 AAGGAGAAACAGGAAGTTGATGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031854629 7:126907299-126907321 AGGGAGGAGGAGGAAGAGGAAGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032309705 7:130773446-130773468 TGGGAGAAGGTGAAAAATGAAGG - Intergenic
1032411812 7:131699738-131699760 AGGTAGAAGCATAAGGATGTGGG + Intergenic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1032650824 7:133876508-133876530 AGAAAGAAGAAGAAAAATGAAGG - Intronic
1032799843 7:135309184-135309206 AGGAAGAAGAAGGAAGAGGAAGG + Intergenic
1032800740 7:135315777-135315799 AGAGGGAAGCAATAAGATGATGG - Intergenic
1032830311 7:135618149-135618171 AGGTACAAGGAGAAAGAAGATGG + Intronic
1032871215 7:135988114-135988136 AGGGCTAAGCAGAAAGTAGAGGG - Intergenic
1032906193 7:136369970-136369992 AGTGAGAAGCAGTCACATGATGG + Intergenic
1032927780 7:136628780-136628802 AGGGAGAGGGAGAGAGATGGTGG - Intergenic
1033206471 7:139427291-139427313 AGGTAGCAGCAGAAACATTAGGG + Intergenic
1033393371 7:140949978-140950000 GGGGAGAAGTAGAAAGATTCAGG - Intergenic
1033454008 7:141486235-141486257 ACGGAGACCCAGAAAGGTGAGGG + Intergenic
1033528951 7:142244232-142244254 AGAGAGAAACAGAGAGAAGAGGG - Intergenic
1033529060 7:142244991-142245013 AGGGAGAGGAAGAAAGGTGCAGG + Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033666591 7:143446452-143446474 GGGAAGAAGGAGACAGATGATGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033832594 7:145271507-145271529 AGGAAGAAGGAGAAAGAAAAAGG + Intergenic
1034221432 7:149449439-149449461 AGGGAAAAGCAGACAGAGAAAGG + Intronic
1035144401 7:156799555-156799577 TAGGAGAAGGAGAGAGATGAAGG - Intronic
1035404772 7:158589708-158589730 AGGGAGAGGGAGAGAGTTGAGGG - Intergenic
1035470677 7:159106858-159106880 AGGGAGGGGCAGAGAGATCAGGG + Intronic
1035470690 7:159106919-159106941 AGGGAGGTGCAGAGAGATCAGGG + Intronic
1035579988 8:733403-733425 TGGTAGAAGCAGAAACTTGATGG + Intronic
1036751462 8:11446111-11446133 AGGGAAAAGAATTAAGATGAGGG + Intronic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037091694 8:14927533-14927555 AGGAAGAGGAAGAAAGAAGAGGG + Intronic
1037222959 8:16547799-16547821 AGGCAGAGGGAGAAATATGAAGG + Intronic
1037303718 8:17482421-17482443 AAGGAGAGGGAGAAAGATGGGGG - Intergenic
1037393876 8:18421797-18421819 AGGCAGAAATAGAAAGTTGAGGG - Intergenic
1037875149 8:22541727-22541749 AGGGAACAACAGAAGGATGATGG - Intergenic
1037930580 8:22877843-22877865 AGGGAGAGGCAGAAAGCTGCAGG + Intronic
1038135361 8:24779962-24779984 AGCTAAAACCAGAAAGATGAAGG + Intergenic
1038663067 8:29513777-29513799 GGGATGAAGCAGAAAGGTGAAGG - Intergenic
1038945041 8:32349836-32349858 ACAGAGAATCAGAAAGAAGATGG - Intronic
1039135130 8:34313563-34313585 AGAGAGAAGCAGAAATAAGGAGG + Intergenic
1039140933 8:34387266-34387288 GTGGAGAAGAACAAAGATGAAGG + Intergenic
1039309140 8:36297019-36297041 TGGAAGAAACAGAAAGATGTGGG + Intergenic
1039317344 8:36387998-36388020 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1039390855 8:37179866-37179888 AGAGAGAAGAAGAAAGAAGAGGG - Intergenic
1039564831 8:38543855-38543877 AGGGAGAATAGGAAAGAGGAGGG + Intergenic
1040033924 8:42850627-42850649 AGTGAGAAGCAGACAGACAATGG + Intronic
1040601175 8:48885149-48885171 AGGGAGTAGCAGCTAGATTAAGG - Intergenic
1041141200 8:54820948-54820970 TAGGCGAAGCAGCAAGATGAGGG + Intergenic
1041162382 8:55058799-55058821 AGGGAGGAGAAGAAAGATAAAGG + Intergenic
1041347925 8:56920676-56920698 AGGGAGAAGCAGAGAAAGGTGGG + Intergenic
1041714730 8:60922989-60923011 AGGGAGAACGGAAAAGATGAGGG + Intergenic
1041982158 8:63874478-63874500 AGGGAAGATCAGAAAGAAGAGGG + Intergenic
1042592814 8:70414265-70414287 AGGCAGAGGCAGAAAGAGAAGGG - Intergenic
1042633323 8:70844681-70844703 TGGGAGAAGTACACAGATGACGG - Intergenic
1042795447 8:72657957-72657979 ATGGAGAAGGAGACAGATGGAGG - Intronic
1042889339 8:73589985-73590007 AGGGAGGAGGAGAAGGAAGAGGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043116902 8:76268099-76268121 AGAGAGAAGCCTAAATATGAGGG - Intergenic
1043155051 8:76768480-76768502 AGGGGGAAAGAGAAAGATGAGGG + Intronic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044399985 8:91759263-91759285 GAGGAGGAGGAGAAAGATGAGGG + Intergenic
1045054499 8:98357697-98357719 AGGAGGAAGCAGAAAGGAGAAGG - Intergenic
1045316984 8:101052058-101052080 GTGGAGCAGCATAAAGATGAAGG - Intergenic
1045324348 8:101106602-101106624 AGAGTGAAGCAGCAGGATGAAGG + Intergenic
1045370147 8:101514913-101514935 AAGGAGAAGAAGAAAGAACAAGG - Intronic
1045769790 8:105722703-105722725 GAGGAGAAGGAGGAAGATGAGGG + Intronic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1045948552 8:107825754-107825776 GAGGAGAGGGAGAAAGATGAGGG + Intergenic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1046103367 8:109640029-109640051 AGGAAGATGAAGAGAGATGAGGG + Intronic
1046184474 8:110694624-110694646 AGGAAGAAGGACAAAGAGGAAGG + Intergenic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1046526632 8:115389274-115389296 AGGTAGAAGCAGAAATATCATGG - Intergenic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046754712 8:117961343-117961365 AGGAAGAAGCATAAAGATTGGGG + Intronic
1046776007 8:118164096-118164118 AGGGAGGAGTAGGAAGAGGAGGG + Intergenic
1046784609 8:118252655-118252677 TGGGAGAAAGAGAAAGAGGAAGG - Intronic
1047248087 8:123161320-123161342 TGGGAGAAGGAGGCAGATGAAGG - Intergenic
1047363472 8:124190965-124190987 AGAGAGAAGAAGAAAAAAGAAGG + Intergenic
1047364098 8:124196406-124196428 AGAGAAAAGCAGATAGTTGAGGG - Intergenic
1047402330 8:124557504-124557526 GGGGAGAAGCAGAAAGCAGCCGG - Intronic
1047609030 8:126502606-126502628 AGGGAGATGTCAAAAGATGAAGG + Intergenic
1047665764 8:127089400-127089422 ACAGAGAAGCAGGAAAATGAGGG + Intergenic
1047724494 8:127672139-127672161 AGGTAGAGGCAGAGAGCTGATGG - Intergenic
1048046270 8:130776043-130776065 AAGGAGAAGCAGCAAGATTGGGG + Intergenic
1048288393 8:133160932-133160954 AGAGAGAAGCAGAAAGAGTGAGG + Intergenic
1048334737 8:133493924-133493946 GGGGAGAAGGAGAGAGAAGAAGG - Intronic
1048759317 8:137774583-137774605 AGAGAGTAGCAGAAACATGTAGG + Intergenic
1049114852 8:140677211-140677233 AGGTACAACCAGAAAAATGATGG + Intronic
1049903874 9:197526-197548 AGGGAGATAGAGTAAGATGATGG - Intergenic
1050632127 9:7571274-7571296 AGAGAGAAAGAGAATGATGATGG + Intergenic
1051190609 9:14507723-14507745 AGTGAGAAGAAGAAAGAGGTTGG + Intergenic
1051221415 9:14852138-14852160 AGGGGGCAGGAGAAGGATGAAGG + Intronic
1051503825 9:17806375-17806397 AGGTAGAAGGAGAAATATTAAGG + Intergenic
1051544556 9:18259602-18259624 AGAGGGGAGCAGAAAGAGGAGGG - Intergenic
1051804522 9:20977169-20977191 ACAGAGAACCAGAAAGATGATGG - Intronic
1051874105 9:21772542-21772564 AGGGAGAAGGGGAAAGACTAAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052685420 9:31749335-31749357 AGGGAGAAATAGAGAGATGTTGG + Intergenic
1053296476 9:36918031-36918053 TAGGAGAAGAAGAGAGATGAGGG - Intronic
1053475916 9:38382017-38382039 AGGTAGAAGCAGACAGATCAGGG - Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053508028 9:38661514-38661536 AGGGAGAAAAGGAAGGATGAAGG + Intergenic
1054149543 9:61590146-61590168 AGAGAAAAAAAGAAAGATGAAGG + Intergenic
1054469303 9:65521249-65521271 AGAGAAAAAAAGAAAGATGAAGG + Intergenic
1056546212 9:87616100-87616122 AGAAGGAAGCAGAAAGGTGAGGG - Intronic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1057226652 9:93296425-93296447 ATGGAGAAGGAGGAAGGTGAGGG - Intronic
1057302504 9:93894958-93894980 AGGGAGAAGCAGGGAGATGCAGG - Intergenic
1057442054 9:95090246-95090268 AGGGAGAGGCAGCAAGTTAATGG + Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058349401 9:104003428-104003450 AGGGAGAAGAGGAAGGGTGAAGG + Intergenic
1058379981 9:104367072-104367094 AGGGATAAGGAAAAAGAGGAGGG - Intergenic
1058552317 9:106127965-106127987 AGGAAGAAGGGGAAAAATGATGG + Intergenic
1058563027 9:106249883-106249905 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058625865 9:106932181-106932203 AGGGAGAAAAAGAAAGCTGGAGG + Intronic
1058731485 9:107854190-107854212 AGGGGAAAGCACCAAGATGATGG - Intergenic
1058985830 9:110207728-110207750 AGGGGGAAGGAGAAAGATGAAGG + Exonic
1058994952 9:110290629-110290651 AGTGAGAAGCAGACAGAAGTGGG - Intergenic
1059072427 9:111152831-111152853 AGGGAGGAGGAGGAAGAGGAAGG + Intergenic
1059168828 9:112105068-112105090 AGAGAGAAGCAGAAATAAAAAGG + Intronic
1059170529 9:112120374-112120396 AGGGAAAAGAAAAAAGAAGAGGG + Intronic
1059218410 9:112589238-112589260 TGGGAGAATCAGAAAAATGAGGG - Intronic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059510184 9:114837897-114837919 TTGGTGAAGAAGAAAGATGAGGG - Intergenic
1059614832 9:115938218-115938240 AAATAGAAGAAGAAAGATGATGG + Intergenic
1059893858 9:118837143-118837165 GGGGACCAGCAGAAAGATGTTGG + Intergenic
1059909294 9:119024660-119024682 AGGGAGAGGAGAAAAGATGAGGG - Intergenic
1060069581 9:120534432-120534454 AGGGAGGAGCAGGATGATAAGGG - Intronic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1060865029 9:126988824-126988846 AGGGAGCAGCAGGAAGAACAAGG + Intronic
1060865456 9:126991694-126991716 ACAGAGACACAGAAAGATGAGGG - Intronic
1061011280 9:127956049-127956071 GGGGACAAGCAGAAAGGTCAGGG + Intronic
1061033026 9:128098316-128098338 AGTGAGAGGCACAAAGATCAGGG - Intronic
1061281937 9:129602583-129602605 AGGGAAAAACAGAGAGAAGAAGG + Intergenic
1061488076 9:130930366-130930388 AGGGAGACGCAGGGAGATGCGGG + Intronic
1061620500 9:131808467-131808489 AGGGAGAAGCAGCCAGCTGCTGG + Intergenic
1061865656 9:133490746-133490768 AAGGAGAAGCAGGGAGAAGAAGG + Intergenic
1061916175 9:133755642-133755664 AGGGAGAGGGAGAAAGAGGGAGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062329808 9:136034089-136034111 AGGGAAAAACAGAGAGATCAAGG + Intronic
1062412296 9:136431483-136431505 AGGGAGATGAGGAAAGGTGAGGG - Intronic
1062412328 9:136431567-136431589 AGGGAGATGAGGAAAGGTGAGGG - Intronic
1062412375 9:136431692-136431714 AGGGAGATGAGGAAAGGTGAGGG - Intronic
1062412422 9:136431817-136431839 CGGGAGATGCGGAAAGGTGAGGG - Exonic
1062524471 9:136972670-136972692 AGGGAGAAGCAGAGACCTGCAGG - Intergenic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638452 9:137503800-137503822 AGGAAGAAGGAAGAAGATGAAGG + Intronic
1062638466 9:137503991-137504013 AGCAAGAAGAAGAAAGAAGAAGG + Intronic
1062638472 9:137504051-137504073 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185498141 X:574756-574778 TGGCAGAATCAGAAAGGTGACGG + Intergenic
1185513673 X:682028-682050 AGGGAGAAGGAGACAGAAAAAGG + Intergenic
1185604457 X:1359896-1359918 AGGGAGAGACAGAGAGATGGAGG - Intronic
1185701260 X:2232133-2232155 AGAGAGGAGGAGAAAGAGGAAGG - Intronic
1185714435 X:2330053-2330075 AGAGAGAAGCAGAGAGACGGCGG + Intronic
1185830057 X:3292881-3292903 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
1185830196 X:3294303-3294325 AAGGAGAAGGAGAAAGAAGGAGG - Intergenic
1185992653 X:4909519-4909541 AGGAAGAAAGAGAAAGAAGAAGG - Intergenic
1185999255 X:4989537-4989559 AGGGAGAAGAAAAAAGAAGTAGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186102595 X:6172922-6172944 AGGAAGAACAAGAAAGCTGATGG + Intronic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186471169 X:9823113-9823135 AGGGAGAAGGAGAAGGGAGAAGG - Intronic
1186639197 X:11437090-11437112 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1186946255 X:14571049-14571071 AGGGGGGAGCAGGAAGAAGAGGG + Intronic
1187025792 X:15434140-15434162 AGGAGGAAGGAGAAAGAAGAAGG + Intronic
1187025806 X:15434240-15434262 AGGAGGAAGGAGAAAGAAGAAGG + Intronic
1187025823 X:15434347-15434369 AGGGGGAAGGAGAAAGAAGGAGG + Intronic
1187167544 X:16818543-16818565 AAGGAGAAGGAGAAAAAAGATGG - Intronic
1187196755 X:17093666-17093688 AGGGTGGAGGAGAAAGATAATGG - Intronic
1187298407 X:18025090-18025112 AGAGAGAAACAGAACCATGAAGG + Intergenic
1187298449 X:18025402-18025424 AGGAAGAAGTAAAAAGAAGATGG - Intergenic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187566094 X:20451126-20451148 AATGAAAAGCAGAGAGATGATGG - Intergenic
1187768343 X:22667827-22667849 AAGGAGGAGCAGGCAGATGATGG - Intergenic
1187977197 X:24714899-24714921 AGTGAGTAGCAGGAAGATCATGG + Intronic
1188583335 X:31742491-31742513 AAGGAGAGGAAGAGAGATGAGGG + Intronic
1188602215 X:31981591-31981613 AAGAAGAACCAGAAAGACGAAGG + Intronic
1188606689 X:32040323-32040345 AGAGAGAAGAAAAAATATGAAGG - Intronic
1188642252 X:32520924-32520946 AGAGAGCTGCAGAAAGAGGATGG - Intronic
1189211425 X:39287260-39287282 AGGGAGAGGCAGCACGAAGAAGG + Intergenic
1189285645 X:39850518-39850540 AAGGAGGAGCAGAAACATAAGGG + Intergenic
1189316632 X:40061562-40061584 GGGGAGAAGCAGTGAGTTGAGGG + Intronic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190158863 X:48016258-48016280 AGGGAGAGGGAGAGGGATGAGGG - Intronic
1190174560 X:48138529-48138551 AGGGAGAGGGAGAGGGATGAGGG - Intergenic
1190220439 X:48509199-48509221 AGGGAGAGTCGGAAAGGTGATGG - Intronic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190711707 X:53076444-53076466 AGAGAGAGACAGAGAGATGAGGG - Intronic
1190774776 X:53543970-53543992 TGGGAGAAAGAGAAAGAGGAAGG + Intronic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192347935 X:70327367-70327389 AGGGAGAAGCTAAAGGATCAGGG + Intronic
1192362127 X:70446695-70446717 TGGGAGAAGCAGCAAAATGGAGG + Intronic
1192369098 X:70498709-70498731 AGGAAGAAGCATAGAGAAGAAGG - Intronic
1192438080 X:71154899-71154921 GGGGGGCAGCAGAAAGAGGAAGG - Intronic
1192475737 X:71440911-71440933 AGAAAGAAGGAGAAAGAAGAAGG - Intronic
1192805720 X:74506691-74506713 GGAGAGACTCAGAAAGATGAGGG + Intronic
1192947711 X:75983937-75983959 AGGGATAAGGAGGAAGAAGAAGG - Intergenic
1193103028 X:77637045-77637067 AGGAGGAAGAAGAAAGAAGAAGG + Intronic
1193198741 X:78663191-78663213 AGGGAGAAGCGGGGAGATGAGGG + Intergenic
1193407801 X:81123551-81123573 AAGGATAAGAAGAAAAATGAAGG + Intronic
1193863281 X:86697294-86697316 AGGGAGAAGCAAAAACAAGGAGG + Intronic
1194049027 X:89045301-89045323 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1194467868 X:94255540-94255562 AGGAAGGAGCAGAGAGATTAAGG + Intergenic
1194969479 X:100327109-100327131 AGATAGAAGCAAACAGATGAGGG + Intronic
1194989962 X:100536817-100536839 AGGGAGAAGCTGAAAGCTGGGGG + Intergenic
1195027560 X:100893176-100893198 TGGGAGAAATAGAAAGATGTTGG + Intergenic
1195385644 X:104311531-104311553 AGAGAGAGACAGAAAGACGAAGG - Intergenic
1195412063 X:104578208-104578230 GCAGAGAAGCAAAAAGATGAGGG + Intronic
1195594806 X:106675479-106675501 AGGCAGAGGAAGAAAGATGAAGG + Intronic
1195647201 X:107245775-107245797 AGAGAGAAACAGAAAGCTGGTGG + Intergenic
1195732723 X:107982210-107982232 AGGGCGGAGAAGACAGATGAGGG - Intronic
1195863222 X:109403192-109403214 AAGAAGGAGCAGATAGATGAGGG - Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196273330 X:113737445-113737467 AGGGGGAAGCAGTAAAATGATGG - Intergenic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1197521835 X:127508533-127508555 AGAGAGAAGCAGACAGAATATGG - Intergenic
1197658736 X:129146832-129146854 GGGGAAAAGGAGAGAGATGATGG + Intergenic
1198034605 X:132788439-132788461 AAGGAGAGGGAGAGAGATGAAGG - Intronic
1198063341 X:133070038-133070060 AGAGACAAGAGGAAAGATGAGGG + Intronic
1198194931 X:134350695-134350717 AGGGAGAAAGAGAGAGAAGATGG - Intergenic
1198653920 X:138892986-138893008 AGGGAGAGAGAGGAAGATGAAGG + Intronic
1198818751 X:140622389-140622411 AAAAAGAAGAAGAAAGATGAAGG + Intergenic
1199005570 X:142692657-142692679 GGGGAGGAGCAGAAGGTTGACGG + Intergenic
1199109926 X:143919733-143919755 AGAGAGAAGGAGGAAGAAGAAGG + Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199194077 X:145006431-145006453 AGAGACAAGCAGAATGAAGACGG + Intergenic
1199297051 X:146171226-146171248 AGGGAAAAGGAGAAAGGAGAAGG - Intergenic
1199585167 X:149407086-149407108 AAGGAGATGCAAAAAGAAGAAGG + Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199751538 X:150824078-150824100 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751568 X:150824223-150824245 AGGAAGAAGAAGAAAGAAGAAGG + Intronic
1199751596 X:150824546-150824568 AGGAAGAAGAAGAAAGAAGGAGG + Intronic
1199760438 X:150900128-150900150 AGGGAAAAGCAGCAAAATGGAGG + Intergenic
1199877234 X:151943459-151943481 AGGGTAAAGAAGAAAAATGATGG - Intergenic
1199949248 X:152693307-152693329 AGGGAGAGAAAGAAAGATAAAGG + Intergenic
1199960428 X:152775142-152775164 AGGGAGAGAAAGAAAGATAAAGG - Intergenic
1201146283 Y:11067085-11067107 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146385 Y:11067399-11067421 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201336413 Y:12885543-12885565 AGGCAGAAACAGAAAATTGAAGG - Intergenic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic
1202130491 Y:21604568-21604590 TGGGAGAATCAAAAAAATGAAGG + Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic