ID: 1095155502

View in Genome Browser
Species Human (GRCh38)
Location 12:38848798-38848820
Sequence TCACCTCTCTTATTTATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095155500_1095155502 7 Left 1095155500 12:38848768-38848790 CCAAATAATAGAAATTTTTTAGC 0: 1
1: 0
2: 2
3: 47
4: 436
Right 1095155502 12:38848798-38848820 TCACCTCTCTTATTTATTCAGGG 0: 1
1: 0
2: 3
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095155502 Original CRISPR TCACCTCTCTTATTTATTCA GGG Intronic