ID: 1095155516

View in Genome Browser
Species Human (GRCh38)
Location 12:38848987-38849009
Sequence TCCTAACCTTGTATATAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095155515_1095155516 7 Left 1095155515 12:38848957-38848979 CCTAAAATTTAAATGTATTATAA 0: 1
1: 0
2: 22
3: 374
4: 1535
Right 1095155516 12:38848987-38849009 TCCTAACCTTGTATATAAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095155516 Original CRISPR TCCTAACCTTGTATATAAGA AGG Intronic
902932127 1:19738976-19738998 TCTTGACCTTGTATCAAAGATGG - Intronic
906724685 1:48035693-48035715 TCCTCTCCTTGTGTAAAAGAGGG + Intergenic
909051280 1:70771664-70771686 TACTAACCTTGAATATAAATAGG - Intergenic
910779625 1:90915074-90915096 TTCTAATTTTGCATATAAGATGG + Intergenic
914892296 1:151636908-151636930 TCCTAAACATTTATATCAGAAGG - Intronic
916505048 1:165421352-165421374 TCATAGCCTTGTATAAAAAAAGG - Intronic
916904231 1:169264249-169264271 TACTAACCTTGAATATAAATGGG + Intronic
916934908 1:169617713-169617735 TCCTGTCCTTTTATAAAAGAAGG + Intronic
917284663 1:173411394-173411416 TCCTAATCTGGACTATAAGAAGG + Intergenic
923687032 1:236160569-236160591 TCCAGACCTTGTTTTTAAGATGG - Intronic
923761202 1:236846555-236846577 TCCTAACCTGGAAAATAACAAGG + Intronic
924362109 1:243253505-243253527 TCCTAACTTTGTAGATAACACGG - Intronic
924650899 1:245926384-245926406 TCTTAAACTGGTATATATGAAGG + Intronic
924676113 1:246179703-246179725 TCTTAACCTTGAGTATATGAAGG + Intronic
1064854046 10:19745328-19745350 TCCTAACCTTGTAAATTATCTGG + Intronic
1067784192 10:49230648-49230670 TCCTAACATTGTTTAATAGAGGG - Intergenic
1067897703 10:50201625-50201647 TCCTAACCTTGTTTGTGACATGG + Intronic
1069019394 10:63468429-63468451 TCATAACTTTGTAAATAACAAGG + Intergenic
1069675380 10:70243011-70243033 TCCAAACTTTGTACATAGGATGG + Intergenic
1070345539 10:75537925-75537947 TCCTAACCGTGTATATACCCTGG + Intronic
1070435392 10:76387235-76387257 TCATAGCCTTGTTTATATGAAGG + Intronic
1071179487 10:82966086-82966108 TATTAACCTTGTATATTAGTAGG + Intronic
1077755980 11:5027796-5027818 TACTAACCTTGAATGTAAGTGGG + Intergenic
1086760268 11:90621358-90621380 TACTAACCTTGAATGTAAGCAGG + Intergenic
1086899472 11:92350279-92350301 TGCTAACCTTGGATATGAAAGGG + Intergenic
1087337356 11:96861678-96861700 TACTAACCTTGAATATAAATGGG - Intergenic
1087551275 11:99653137-99653159 CCCTTACCTTGTATTTAATATGG - Intronic
1088987263 11:114920288-114920310 TCCACACTTTATATATAAGAAGG - Intergenic
1091965115 12:4734192-4734214 TCCTTTCCTTATTTATAAGACGG - Intronic
1093686091 12:22056016-22056038 TCCTAACTCCATATATAAGAAGG + Intronic
1094529572 12:31261247-31261269 GCATAACCTTATATATAATAGGG + Intergenic
1095155516 12:38848987-38849009 TCCTAACCTTGTATATAAGAAGG + Intronic
1095278590 12:40322166-40322188 TCCTTACCTTTTCTACAAGAAGG - Exonic
1095308926 12:40672326-40672348 TCCAAACCTTCTATTTAGGATGG + Intergenic
1098166926 12:67708197-67708219 ACTTCACCTTGTATGTAAGAGGG + Intergenic
1098704224 12:73666175-73666197 TACTAACCTTGAATATAAATGGG - Intergenic
1100246218 12:92759836-92759858 TCCTAGCCCTGTATATCAGTTGG + Intronic
1104625425 12:130349733-130349755 TTCCAACCTTGTATATAACCAGG + Intronic
1105658549 13:22467771-22467793 TCAAAACCTTGTATATAAGTGGG - Intergenic
1106276359 13:28211886-28211908 TCCCAACCTTGTATAGAAAGGGG + Intronic
1106412115 13:29517753-29517775 GCCTAACCTGGTATACCAGATGG - Exonic
1107634865 13:42381912-42381934 TCCTAATCTTGTCTATAACAGGG - Intergenic
1110657257 13:78014721-78014743 TCCTCACCTACAATATAAGAAGG - Intergenic
1110906222 13:80893649-80893671 CCCTAACCCTGTGTCTAAGATGG + Intergenic
1111660168 13:91199981-91200003 TCCTAACATTTTGTATATGAAGG + Intergenic
1114134939 14:19836623-19836645 TACTAACCTTGAATGTAAAAGGG + Intergenic
1115939016 14:38588605-38588627 TACTAACCTTGAATATAAATGGG - Intergenic
1116794138 14:49371936-49371958 TCCTAACCTTGCAAATATGCAGG + Intergenic
1125198974 15:37082332-37082354 TCTAAACATTGTATAAAAGAGGG - Intronic
1125867187 15:43063482-43063504 TATTAACCTTGTACATAAGACGG + Intronic
1127623749 15:60759830-60759852 TCCTATCTTTGTATCAAAGATGG - Intronic
1130424216 15:83778768-83778790 TACTAACCTTGAATGTAAGTGGG + Intronic
1134301215 16:12993182-12993204 TCTGAACCTTTTATATATGAGGG - Intronic
1135958223 16:26974392-26974414 TCATGGCCTTGTATGTAAGACGG - Intergenic
1137311539 16:47264967-47264989 TCATATCCTTGTTTGTAAGATGG + Intronic
1143082735 17:4393850-4393872 TCCCCACCTTGCAGATAAGATGG + Intergenic
1143806781 17:9435112-9435134 TCATAACCTTGAAAATAAGTTGG + Intronic
1146413014 17:32604904-32604926 TCCTAACCTTGAAAGTAAGCTGG + Intronic
1149921437 17:60663577-60663599 TCCAAACTTAGGATATAAGAGGG + Exonic
1151012938 17:70522124-70522146 TCCTAAGCCTGCAGATAAGAGGG + Intergenic
1155673532 18:28401647-28401669 TCCTAACCTTGTATATTTTCTGG - Intergenic
1162314176 19:9927453-9927475 TTCTAACCATGTTTAAAAGAGGG - Intronic
1162602678 19:11680957-11680979 TACTAACCTTGAATGTAAGCAGG - Intergenic
1164450804 19:28362746-28362768 TCTTCACCTTGTCTATAGGACGG + Intergenic
1165574193 19:36800227-36800249 TCTTAACCTTGTTTATGACACGG + Intergenic
1168450788 19:56465047-56465069 TCCTACCCTTTTTTATAAAAAGG + Intronic
926351328 2:11997717-11997739 TCATAATTTTGTATATGAGATGG + Intergenic
926448872 2:12977971-12977993 TCGAAAACTTGTATATAAGTAGG + Intergenic
926651523 2:15351909-15351931 ACCTAACCTTGTGGATGAGAGGG - Intronic
926800695 2:16657606-16657628 TCCTACCTTTGGATATTAGAGGG - Intronic
929321877 2:40553981-40554003 TCCTAGCCTTGGAGAGAAGATGG + Intronic
931889821 2:66659784-66659806 TACTCACCTTGAATATAAGTGGG - Intergenic
934606671 2:95700447-95700469 CCTTAATCTTGTAAATAAGAAGG - Intergenic
935042057 2:99441388-99441410 GCCTTACCTTGTATATCAGGTGG - Intronic
939371508 2:141307600-141307622 TCCTAACCTTGGATGTAAACAGG - Intronic
939444876 2:142296136-142296158 TCTTGACTTTGTATTTAAGATGG + Intergenic
941460215 2:165761836-165761858 TCCTTACCTTTTAAATTAGAGGG + Intronic
943435304 2:187858386-187858408 TCCCAACCTTGTATAGAATTTGG - Intergenic
943878462 2:193105459-193105481 TTCTATCCTTGTTTGTAAGAAGG - Intergenic
944208988 2:197186943-197186965 TCTTAACCTTTTATATACCATGG - Intronic
944442868 2:199760487-199760509 TTAACACCTTGTATATAAGAGGG + Intergenic
945502787 2:210598362-210598384 TACTAACCTTGAATATAAACAGG + Intronic
946078480 2:217096090-217096112 CCCTAACTTTTTATATAATATGG - Intergenic
1169683039 20:8238575-8238597 TCCTCACTTTGTATATATAAAGG - Intronic
1170299888 20:14871672-14871694 TACTAACCTTGAATATAAGTGGG + Intronic
1171860831 20:30401179-30401201 TGATATCCTTGTATACAAGATGG - Intergenic
1177662337 21:24101376-24101398 TACTAACCTTGAATATAAATGGG - Intergenic
1178053651 21:28775146-28775168 TCCTAACCTCCAAAATAAGAGGG - Intergenic
1178212388 21:30551249-30551271 TACTAACCTTGAATGTAAGTGGG - Intronic
1179905278 21:44419349-44419371 CCCTCACCTTGTCTGTAAGATGG + Intronic
1184589586 22:45472943-45472965 GCTGAACATTGTATATAAGAAGG + Intergenic
1184905366 22:47481677-47481699 TGCTAACCATGTATCTAATAAGG + Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
957701853 3:83725650-83725672 TGGTAACATTGTATATAAGGAGG - Intergenic
958956314 3:100468923-100468945 TCCTAGCCTTGTGTATTAGTTGG + Intergenic
959262644 3:104101219-104101241 TACTAACCTTGAATATAAACAGG - Intergenic
960468971 3:118036658-118036680 TCATAACCGTGTATTTAATAAGG - Intergenic
961051958 3:123754389-123754411 TCCAGACATTGTAAATAAGATGG - Intronic
962997526 3:140645969-140645991 TACTAACCTTGAATATAAACAGG - Intergenic
963571413 3:147001606-147001628 TAAAAACCATGTATATAAGATGG + Intergenic
965810755 3:172589638-172589660 TACTAACCTTGAATATAAATGGG - Intergenic
967575395 3:191084534-191084556 TCGTATGCTTGTAAATAAGATGG - Intergenic
970986005 4:22158934-22158956 TACTAACCTTGAATGTAAGTGGG - Intergenic
971556284 4:28016190-28016212 ACTTAACCTTGTATATTACACGG + Intergenic
974376728 4:61087745-61087767 TCCTAACCTTTAACACAAGAAGG - Intergenic
977627085 4:99199269-99199291 TGCTAACCTTGAATGTAAGTGGG - Intergenic
978043231 4:104094803-104094825 TACTAACCTTGAATGTAAAAGGG + Intergenic
978162002 4:105559788-105559810 TCACAACCTAGTATAGAAGAAGG - Intronic
978898100 4:113914520-113914542 TCCTAACCATGGCTAAAAGAAGG - Intronic
982938316 4:161515112-161515134 TTCTAACTTTGTATATAAAATGG - Intronic
983138436 4:164116907-164116929 TTTTAACTTTGTATAAAAGATGG - Intronic
984903178 4:184602817-184602839 TATTAACCTTGAATATAAGTGGG + Intergenic
986946961 5:13033121-13033143 TTCTAAGCTGGTATACAAGAGGG - Intergenic
987744998 5:21959375-21959397 TACTAACCTTGAATGTAAGTGGG + Intronic
988592107 5:32557942-32557964 GCCTAACCTTTTCTGTAAGAGGG - Intronic
990266219 5:54079486-54079508 TCCTATACTTGAAAATAAGAGGG - Intronic
990290188 5:54342059-54342081 TCCAAACCTTAGATACAAGAGGG - Intergenic
991449277 5:66734364-66734386 TCCTGAACTTGAATATCAGATGG + Intronic
991765205 5:69969505-69969527 TACTAACCTTGAATGTAAGTGGG + Intergenic
991782118 5:70148648-70148670 TACTAACCTTGAATGTAAGTGGG - Intergenic
991844439 5:70844576-70844598 TACTAACCTTGAATGTAAGTGGG + Intergenic
991874561 5:71148963-71148985 TACTAACCTTGAATGTAAGTGGG - Intergenic
993098851 5:83511708-83511730 TCCTAACATTGCATATTGGAAGG - Intronic
995270803 5:110217750-110217772 TACTAACCTTGAATATAAATGGG - Intergenic
996606200 5:125326413-125326435 TCCTAACCTTGCCTGGAAGAGGG - Intergenic
998175899 5:139901983-139902005 CCCTCACCTTCTATATGAGAAGG - Intronic
998275734 5:140751692-140751714 TACTAACCTTGAATATAAATGGG - Intergenic
1000031934 5:157409235-157409257 TACTAACCTTGGATATAAGTGGG + Intronic
1000982293 5:167828804-167828826 TCCCAACCTTCTATGTAAAAGGG - Intronic
1003437430 6:6104668-6104690 TACTAACCTTGAATGTAAGTGGG - Intergenic
1003715106 6:8637553-8637575 TCTTAACTTTGTATCTCAGAAGG - Intergenic
1006864631 6:37199360-37199382 TTATAACCTAGTATATAATAGGG + Intergenic
1007141879 6:39584108-39584130 TTCTGAGCTTTTATATAAGATGG + Intronic
1008298690 6:49807649-49807671 TACTAACCTTGTATGTAAATGGG + Intergenic
1008418740 6:51272586-51272608 TCCTGCCCTTGAATCTAAGAGGG - Intergenic
1009034547 6:58100313-58100335 TACTAACCTTGAATATAAATGGG + Intergenic
1011489814 6:87879649-87879671 TCCTAACCATGCAAATGAGAAGG + Intergenic
1011934550 6:92759070-92759092 TTCTATCCTTGTGCATAAGATGG - Intergenic
1012134474 6:95538956-95538978 TGCTAACCTTGAATGTAAAAGGG - Intergenic
1013080855 6:106811231-106811253 TACTAACCTTGGATATAAACGGG + Intergenic
1014420407 6:121236757-121236779 TCCTCACATTTTATATAAAATGG - Intronic
1014569254 6:122988350-122988372 TACTAACCTTAAATATAAGTGGG + Intergenic
1016844751 6:148559397-148559419 TCCTAACCTAGGAAAGAAGAGGG - Intergenic
1031039574 7:116825283-116825305 TACTAACCTTGAATGTAAGTGGG - Intronic
1032910822 7:136427716-136427738 TCCTAACATAGAATTTAAGAGGG + Intergenic
1038135834 8:24784684-24784706 TCCTCACCTTCTATAAAACAAGG + Intergenic
1039189394 8:34955456-34955478 TTCATAACTTGTATATAAGACGG - Intergenic
1041595234 8:59642918-59642940 TCTTTATCTTGTATGTAAGAGGG + Intergenic
1043419312 8:80082907-80082929 TCCTAAGATTGTATCTAAGCAGG - Intronic
1043798915 8:84581339-84581361 TCATAACCGTGGATATGAGAAGG - Intronic
1046163862 8:110403168-110403190 TCTTAATCTTGTAAATAATAAGG - Intergenic
1046763991 8:118050004-118050026 TCTTGACCTTGAATAAAAGAAGG - Intronic
1047167492 8:122455596-122455618 TCCAAAACTTGGAAATAAGAGGG + Intergenic
1048412946 8:134194668-134194690 TCCTAACCTTGTATATGTCATGG + Intergenic
1049178676 8:141209195-141209217 TTCTAACCTTGTACCTCAGACGG - Intronic
1050777904 9:9290359-9290381 TGCAAACCTTGTATATGACAAGG - Intronic
1051703279 9:19848151-19848173 TACTAAACTTGTATAGAAGAGGG + Intergenic
1052132290 9:24863049-24863071 TCATAAGCTTGTCTATAAAAAGG + Intergenic
1052173534 9:25429704-25429726 TAATAACCTTGAATATAAAAAGG + Intergenic
1053960210 9:43544905-43544927 CTCTAACCTGGTATATAACAGGG - Intergenic
1053981870 9:43919815-43919837 CTCTAACCTGGTATATAACAGGG - Intergenic
1053989025 9:44043526-44043548 CTCTAACCTGGTATATAACAGGG - Intergenic
1054009915 9:44408211-44408233 CTCTAACCTGGTATATAACAGGG - Intergenic
1054016482 9:44521345-44521367 CCCAAACCTGGTATATAAAAGGG - Intergenic
1054018476 9:44555711-44555733 TTCAAACCTGGTATATAACAGGG - Intergenic
1054032840 9:44801838-44801860 TTCAAACCTGGTATATAACAGGG - Intergenic
1054041493 9:44949887-44949909 CTCTAACCTGGTATATAACAGGG - Intergenic
1054082174 9:60632583-60632605 TTCAAACCTGGTATATAAAAGGG + Intergenic
1054085035 9:60682064-60682086 CCCAAACCTGGTATATAACAGGG + Intergenic
1058534871 9:105948575-105948597 TACTAACCTTGAATGTAAGTAGG - Intergenic
1058757506 9:108096883-108096905 TCTTGACCTTGTGTATATGAGGG - Intergenic
1059597495 9:115738033-115738055 TACTAACCCTAGATATAAGAGGG - Intergenic
1203598914 Un_KI270747v1:187189-187211 TTCAAACCTGGTATATAACAGGG - Intergenic
1203599562 Un_KI270747v1:198237-198259 TTCAAACCTGGTATATAAAAGGG - Intergenic
1186149652 X:6660795-6660817 TATTAACCTGGGATATAAGATGG - Intergenic
1187488251 X:19725034-19725056 TTCTAACTTTGTTTATGAGATGG - Intronic
1188931167 X:36113081-36113103 TACTAACCTTGAATGTAAGAGGG - Intronic
1193028911 X:76876857-76876879 TACTAACCTTGTATATAAATGGG + Intergenic
1193388734 X:80901924-80901946 TACTAACCTTGAATATATGTGGG + Intergenic
1194848087 X:98837193-98837215 TATTAACCTTGTATATAAACAGG - Intergenic
1195015589 X:100776909-100776931 GACTAGCCTTGTATAGAAGAAGG + Intergenic
1195544329 X:106098487-106098509 TACTAACCTTGAATATAAATGGG - Intergenic
1197032133 X:121829074-121829096 TCCTGACATTATATGTAAGACGG + Intergenic
1197093028 X:122560915-122560937 TACTAACCTTGAATATAAACAGG + Intergenic
1197370384 X:125619666-125619688 TACTAACCTTGAATATAAATGGG - Intergenic
1197388501 X:125830135-125830157 TGCTAACCTTGAATATAAACAGG + Intergenic
1197474385 X:126902632-126902654 TACTAACCTTGAATATAAATAGG + Intergenic
1199328131 X:146525748-146525770 TCCTTACCTGGTATACAAGGGGG - Intergenic
1200855283 Y:7931318-7931340 TCATAACCCCATATATAAGAAGG + Intergenic
1202272176 Y:23083006-23083028 TCCTGACCTTTTCTGTAAGAGGG - Intergenic
1202293850 Y:23337676-23337698 TCCTGACCTTTTCTGTAAGAGGG + Intergenic
1202425173 Y:24716750-24716772 TCCTGACCTTTTCTGTAAGAGGG - Intergenic
1202445616 Y:24953335-24953357 TCCTGACCTTTTCTGTAAGAGGG + Intergenic