ID: 1095160191

View in Genome Browser
Species Human (GRCh38)
Location 12:38906089-38906111
Sequence ATAACGGGGCAGTTAGGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095160191_1095160207 27 Left 1095160191 12:38906089-38906111 CCCGTTCCTAACTGCCCCGTTAT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1095160207 12:38906139-38906161 CACCTCGCCCTCGGAGCTCTTGG 0: 1
1: 0
2: 1
3: 13
4: 175
1095160191_1095160206 18 Left 1095160191 12:38906089-38906111 CCCGTTCCTAACTGCCCCGTTAT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1095160206 12:38906130-38906152 ATTGGTTCTCACCTCGCCCTCGG 0: 1
1: 0
2: 0
3: 6
4: 80
1095160191_1095160208 28 Left 1095160191 12:38906089-38906111 CCCGTTCCTAACTGCCCCGTTAT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1095160208 12:38906140-38906162 ACCTCGCCCTCGGAGCTCTTGGG 0: 1
1: 0
2: 1
3: 31
4: 387
1095160191_1095160198 0 Left 1095160191 12:38906089-38906111 CCCGTTCCTAACTGCCCCGTTAT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1095160198 12:38906112-38906134 AAGGTCCCCCTCCCCACAATTGG 0: 1
1: 0
2: 0
3: 20
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095160191 Original CRISPR ATAACGGGGCAGTTAGGAAC GGG (reversed) Intronic