ID: 1095166032

View in Genome Browser
Species Human (GRCh38)
Location 12:38973104-38973126
Sequence CACACTTAGCACTCAGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095166032_1095166033 -9 Left 1095166032 12:38973104-38973126 CCAAGATCTGAGTGCTAAGTGTG No data
Right 1095166033 12:38973118-38973140 CTAAGTGTGCTTGTTGCTACTGG No data
1095166032_1095166034 -8 Left 1095166032 12:38973104-38973126 CCAAGATCTGAGTGCTAAGTGTG No data
Right 1095166034 12:38973119-38973141 TAAGTGTGCTTGTTGCTACTGGG No data
1095166032_1095166035 25 Left 1095166032 12:38973104-38973126 CCAAGATCTGAGTGCTAAGTGTG No data
Right 1095166035 12:38973152-38973174 TATATATATTCACCTATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095166032 Original CRISPR CACACTTAGCACTCAGATCT TGG (reversed) Intergenic
No off target data available for this crispr