ID: 1095166428

View in Genome Browser
Species Human (GRCh38)
Location 12:38978685-38978707
Sequence GAAGACTTTTAGGCCCGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095166428_1095166435 23 Left 1095166428 12:38978685-38978707 CCATGCCGGGCCTAAAAGTCTTC No data
Right 1095166435 12:38978731-38978753 CATTAGATCAAAGGAAAACATGG No data
1095166428_1095166433 14 Left 1095166428 12:38978685-38978707 CCATGCCGGGCCTAAAAGTCTTC No data
Right 1095166433 12:38978722-38978744 GATCCATGACATTAGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095166428 Original CRISPR GAAGACTTTTAGGCCCGGCA TGG (reversed) Intergenic
No off target data available for this crispr