ID: 1095166429

View in Genome Browser
Species Human (GRCh38)
Location 12:38978690-38978712
Sequence TTAGGGAAGACTTTTAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095166429_1095166433 9 Left 1095166429 12:38978690-38978712 CCGGGCCTAAAAGTCTTCCCTAA No data
Right 1095166433 12:38978722-38978744 GATCCATGACATTAGATCAAAGG No data
1095166429_1095166435 18 Left 1095166429 12:38978690-38978712 CCGGGCCTAAAAGTCTTCCCTAA No data
Right 1095166435 12:38978731-38978753 CATTAGATCAAAGGAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095166429 Original CRISPR TTAGGGAAGACTTTTAGGCC CGG (reversed) Intergenic
No off target data available for this crispr