ID: 1095166433

View in Genome Browser
Species Human (GRCh38)
Location 12:38978722-38978744
Sequence GATCCATGACATTAGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095166431_1095166433 -8 Left 1095166431 12:38978707-38978729 CCCTAATAATTTACTGATCCATG No data
Right 1095166433 12:38978722-38978744 GATCCATGACATTAGATCAAAGG No data
1095166429_1095166433 9 Left 1095166429 12:38978690-38978712 CCGGGCCTAAAAGTCTTCCCTAA No data
Right 1095166433 12:38978722-38978744 GATCCATGACATTAGATCAAAGG No data
1095166428_1095166433 14 Left 1095166428 12:38978685-38978707 CCATGCCGGGCCTAAAAGTCTTC No data
Right 1095166433 12:38978722-38978744 GATCCATGACATTAGATCAAAGG No data
1095166427_1095166433 17 Left 1095166427 12:38978682-38978704 CCGCCATGCCGGGCCTAAAAGTC No data
Right 1095166433 12:38978722-38978744 GATCCATGACATTAGATCAAAGG No data
1095166430_1095166433 4 Left 1095166430 12:38978695-38978717 CCTAAAAGTCTTCCCTAATAATT No data
Right 1095166433 12:38978722-38978744 GATCCATGACATTAGATCAAAGG No data
1095166432_1095166433 -9 Left 1095166432 12:38978708-38978730 CCTAATAATTTACTGATCCATGA No data
Right 1095166433 12:38978722-38978744 GATCCATGACATTAGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095166433 Original CRISPR GATCCATGACATTAGATCAA AGG Intergenic
No off target data available for this crispr