ID: 1095168550

View in Genome Browser
Species Human (GRCh38)
Location 12:39005055-39005077
Sequence TGTCATGCCAAGATTGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095168550_1095168551 -6 Left 1095168550 12:39005055-39005077 CCTGAAACAATCTTGGCATGACA No data
Right 1095168551 12:39005072-39005094 ATGACACTGAGAGTAGAAAGAGG No data
1095168550_1095168552 20 Left 1095168550 12:39005055-39005077 CCTGAAACAATCTTGGCATGACA No data
Right 1095168552 12:39005098-39005120 ACTGCAGTAGCAACTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095168550 Original CRISPR TGTCATGCCAAGATTGTTTC AGG (reversed) Intergenic
No off target data available for this crispr