ID: 1095169687

View in Genome Browser
Species Human (GRCh38)
Location 12:39019725-39019747
Sequence TGCCAAGGCAGTATTTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095169681_1095169687 20 Left 1095169681 12:39019682-39019704 CCTTTTGACTAAAGAGTGCTTGG No data
Right 1095169687 12:39019725-39019747 TGCCAAGGCAGTATTTGCCATGG No data
1095169684_1095169687 -3 Left 1095169684 12:39019705-39019727 CCCTGAATTATCAGAAGTGGTGC No data
Right 1095169687 12:39019725-39019747 TGCCAAGGCAGTATTTGCCATGG No data
1095169685_1095169687 -4 Left 1095169685 12:39019706-39019728 CCTGAATTATCAGAAGTGGTGCC No data
Right 1095169687 12:39019725-39019747 TGCCAAGGCAGTATTTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095169687 Original CRISPR TGCCAAGGCAGTATTTGCCA TGG Intergenic
No off target data available for this crispr