ID: 1095170171

View in Genome Browser
Species Human (GRCh38)
Location 12:39025751-39025773
Sequence CTGTTTGAGTACATTTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095170166_1095170171 -4 Left 1095170166 12:39025732-39025754 CCTCTCAATGCCCTCCATACTGT No data
Right 1095170171 12:39025751-39025773 CTGTTTGAGTACATTTATATGGG No data
1095170165_1095170171 3 Left 1095170165 12:39025725-39025747 CCTTGTTCCTCTCAATGCCCTCC No data
Right 1095170171 12:39025751-39025773 CTGTTTGAGTACATTTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095170171 Original CRISPR CTGTTTGAGTACATTTATAT GGG Intergenic
No off target data available for this crispr