ID: 1095178469

View in Genome Browser
Species Human (GRCh38)
Location 12:39120068-39120090
Sequence GGGTGGGGATGTTGTGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095178469_1095178478 29 Left 1095178469 12:39120068-39120090 CCCTTTTCACAACATCCCCACCC No data
Right 1095178478 12:39120120-39120142 TGGCCATTCTTGCAGGAGTAAGG 0: 835
1: 1117
2: 909
3: 572
4: 502
1095178469_1095178476 9 Left 1095178469 12:39120068-39120090 CCCTTTTCACAACATCCCCACCC No data
Right 1095178476 12:39120100-39120122 ACTTTTTGATTTTTTGATTATGG 0: 11
1: 206
2: 587
3: 859
4: 2232
1095178469_1095178477 22 Left 1095178469 12:39120068-39120090 CCCTTTTCACAACATCCCCACCC No data
Right 1095178477 12:39120113-39120135 TTGATTATGGCCATTCTTGCAGG 0: 612
1: 1069
2: 1033
3: 855
4: 2407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095178469 Original CRISPR GGGTGGGGATGTTGTGAAAA GGG (reversed) Intergenic
No off target data available for this crispr