ID: 1095180343

View in Genome Browser
Species Human (GRCh38)
Location 12:39140872-39140894
Sequence TGACACGCACAGTCTCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095180343_1095180347 11 Left 1095180343 12:39140872-39140894 CCATGCAGAGACTGTGCGTGTCA No data
Right 1095180347 12:39140906-39140928 CCAGATTGGAATGTCAGGATAGG No data
1095180343_1095180345 6 Left 1095180343 12:39140872-39140894 CCATGCAGAGACTGTGCGTGTCA No data
Right 1095180345 12:39140901-39140923 CTATTCCAGATTGGAATGTCAGG No data
1095180343_1095180344 -3 Left 1095180343 12:39140872-39140894 CCATGCAGAGACTGTGCGTGTCA No data
Right 1095180344 12:39140892-39140914 TCACAGTGACTATTCCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095180343 Original CRISPR TGACACGCACAGTCTCTGCA TGG (reversed) Intergenic
No off target data available for this crispr