ID: 1095180955

View in Genome Browser
Species Human (GRCh38)
Location 12:39145589-39145611
Sequence TGGAGAGCAGGCGACACCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095180939_1095180955 24 Left 1095180939 12:39145542-39145564 CCCGGCGCCAAAGTCCCGACAGT No data
Right 1095180955 12:39145589-39145611 TGGAGAGCAGGCGACACCGAGGG No data
1095180945_1095180955 10 Left 1095180945 12:39145556-39145578 CCCGACAGTGGCGGACGCCGGCA No data
Right 1095180955 12:39145589-39145611 TGGAGAGCAGGCGACACCGAGGG No data
1095180940_1095180955 23 Left 1095180940 12:39145543-39145565 CCGGCGCCAAAGTCCCGACAGTG No data
Right 1095180955 12:39145589-39145611 TGGAGAGCAGGCGACACCGAGGG No data
1095180938_1095180955 29 Left 1095180938 12:39145537-39145559 CCGGTCCCGGCGCCAAAGTCCCG No data
Right 1095180955 12:39145589-39145611 TGGAGAGCAGGCGACACCGAGGG No data
1095180946_1095180955 9 Left 1095180946 12:39145557-39145579 CCGACAGTGGCGGACGCCGGCAC No data
Right 1095180955 12:39145589-39145611 TGGAGAGCAGGCGACACCGAGGG No data
1095180951_1095180955 -7 Left 1095180951 12:39145573-39145595 CCGGCACCAGGGGCGATGGAGAG No data
Right 1095180955 12:39145589-39145611 TGGAGAGCAGGCGACACCGAGGG No data
1095180943_1095180955 17 Left 1095180943 12:39145549-39145571 CCAAAGTCCCGACAGTGGCGGAC No data
Right 1095180955 12:39145589-39145611 TGGAGAGCAGGCGACACCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095180955 Original CRISPR TGGAGAGCAGGCGACACCGA GGG Intergenic