ID: 1095184943

View in Genome Browser
Species Human (GRCh38)
Location 12:39190505-39190527
Sequence ATGAACCAGATGCCAAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095184943_1095184947 -9 Left 1095184943 12:39190505-39190527 CCCTTCCTTGGCATCTGGTTCAT No data
Right 1095184947 12:39190519-39190541 CTGGTTCATGATAAGGTTTCAGG No data
1095184943_1095184949 27 Left 1095184943 12:39190505-39190527 CCCTTCCTTGGCATCTGGTTCAT No data
Right 1095184949 12:39190555-39190577 TCCAAATCAGCTGATGATTTTGG No data
1095184943_1095184948 2 Left 1095184943 12:39190505-39190527 CCCTTCCTTGGCATCTGGTTCAT No data
Right 1095184948 12:39190530-39190552 TAAGGTTTCAGGTGTCTTGATGG 0: 62
1: 52
2: 44
3: 21
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095184943 Original CRISPR ATGAACCAGATGCCAAGGAA GGG (reversed) Intergenic
No off target data available for this crispr