ID: 1095186760

View in Genome Browser
Species Human (GRCh38)
Location 12:39209304-39209326
Sequence TCTCCTGGATAATGTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095186760_1095186762 1 Left 1095186760 12:39209304-39209326 CCTTCAGGACATTATCCAGGAGA No data
Right 1095186762 12:39209328-39209350 CTTCCCCAACCTAGCGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095186760 Original CRISPR TCTCCTGGATAATGTCCTGA AGG (reversed) Intergenic
No off target data available for this crispr