ID: 1095186762

View in Genome Browser
Species Human (GRCh38)
Location 12:39209328-39209350
Sequence CTTCCCCAACCTAGCGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095186756_1095186762 17 Left 1095186756 12:39209288-39209310 CCAAGTTGGAAAACACCCTTCAG 0: 27
1: 1582
2: 6161
3: 2079
4: 753
Right 1095186762 12:39209328-39209350 CTTCCCCAACCTAGCGAGACAGG No data
1095186760_1095186762 1 Left 1095186760 12:39209304-39209326 CCTTCAGGACATTATCCAGGAGA No data
Right 1095186762 12:39209328-39209350 CTTCCCCAACCTAGCGAGACAGG No data
1095186759_1095186762 2 Left 1095186759 12:39209303-39209325 CCCTTCAGGACATTATCCAGGAG No data
Right 1095186762 12:39209328-39209350 CTTCCCCAACCTAGCGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095186762 Original CRISPR CTTCCCCAACCTAGCGAGAC AGG Intergenic
No off target data available for this crispr