ID: 1095187400

View in Genome Browser
Species Human (GRCh38)
Location 12:39216689-39216711
Sequence CCTAACCCCCACACTGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095187396_1095187400 -8 Left 1095187396 12:39216674-39216696 CCGGAAATTGGTTCCCCTAACCC No data
Right 1095187400 12:39216689-39216711 CCTAACCCCCACACTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095187400 Original CRISPR CCTAACCCCCACACTGCTCA AGG Intergenic
No off target data available for this crispr