ID: 1095187580

View in Genome Browser
Species Human (GRCh38)
Location 12:39219032-39219054
Sequence CATTATGCCCAGAGTTTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095187580_1095187582 12 Left 1095187580 12:39219032-39219054 CCAAGTAAACTCTGGGCATAATG No data
Right 1095187582 12:39219067-39219089 AAATTTATCAGTGATAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095187580 Original CRISPR CATTATGCCCAGAGTTTACT TGG (reversed) Intergenic
No off target data available for this crispr