ID: 1095190258

View in Genome Browser
Species Human (GRCh38)
Location 12:39250137-39250159
Sequence AGCTATCTACAGAGGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095190258_1095190263 15 Left 1095190258 12:39250137-39250159 CCTGCCATCCTCTGTAGATAGCT No data
Right 1095190263 12:39250175-39250197 AACAGCTTTTGACCTGCCATTGG No data
1095190258_1095190261 -10 Left 1095190258 12:39250137-39250159 CCTGCCATCCTCTGTAGATAGCT No data
Right 1095190261 12:39250150-39250172 GTAGATAGCTACTTTCCTTTTGG No data
1095190258_1095190264 25 Left 1095190258 12:39250137-39250159 CCTGCCATCCTCTGTAGATAGCT No data
Right 1095190264 12:39250185-39250207 GACCTGCCATTGGCCCTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095190258 Original CRISPR AGCTATCTACAGAGGATGGC AGG (reversed) Intergenic
No off target data available for this crispr