ID: 1095190935

View in Genome Browser
Species Human (GRCh38)
Location 12:39257310-39257332
Sequence CCCTGAAGGCAGAGCTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095190929_1095190935 5 Left 1095190929 12:39257282-39257304 CCATGGTACCTGCAGCAAGTCTC No data
Right 1095190935 12:39257310-39257332 CCCTGAAGGCAGAGCTCAGAAGG No data
1095190926_1095190935 20 Left 1095190926 12:39257267-39257289 CCTGCCCAGCAGAGACCATGGTA No data
Right 1095190935 12:39257310-39257332 CCCTGAAGGCAGAGCTCAGAAGG No data
1095190928_1095190935 15 Left 1095190928 12:39257272-39257294 CCAGCAGAGACCATGGTACCTGC No data
Right 1095190935 12:39257310-39257332 CCCTGAAGGCAGAGCTCAGAAGG No data
1095190927_1095190935 16 Left 1095190927 12:39257271-39257293 CCCAGCAGAGACCATGGTACCTG No data
Right 1095190935 12:39257310-39257332 CCCTGAAGGCAGAGCTCAGAAGG No data
1095190932_1095190935 -3 Left 1095190932 12:39257290-39257312 CCTGCAGCAAGTCTCAGGGACCC No data
Right 1095190935 12:39257310-39257332 CCCTGAAGGCAGAGCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095190935 Original CRISPR CCCTGAAGGCAGAGCTCAGA AGG Intergenic
No off target data available for this crispr