ID: 1095193691

View in Genome Browser
Species Human (GRCh38)
Location 12:39287770-39287792
Sequence GCAAAGTTTTTTTCTGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095193691_1095193695 9 Left 1095193691 12:39287770-39287792 CCCTTTACAGAAAAAAACTTTGC No data
Right 1095193695 12:39287802-39287824 AAGTTTGATTCCTCCAGGACAGG No data
1095193691_1095193694 4 Left 1095193691 12:39287770-39287792 CCCTTTACAGAAAAAAACTTTGC No data
Right 1095193694 12:39287797-39287819 CTTCGAAGTTTGATTCCTCCAGG No data
1095193691_1095193697 13 Left 1095193691 12:39287770-39287792 CCCTTTACAGAAAAAAACTTTGC No data
Right 1095193697 12:39287806-39287828 TTGATTCCTCCAGGACAGGGAGG No data
1095193691_1095193696 10 Left 1095193691 12:39287770-39287792 CCCTTTACAGAAAAAAACTTTGC No data
Right 1095193696 12:39287803-39287825 AGTTTGATTCCTCCAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095193691 Original CRISPR GCAAAGTTTTTTTCTGTAAA GGG (reversed) Intergenic
No off target data available for this crispr