ID: 1095194133

View in Genome Browser
Species Human (GRCh38)
Location 12:39292839-39292861
Sequence GAGGGTTGGGAGGGTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 342}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095194133 Original CRISPR GAGGGTTGGGAGGGTGCTTC TGG (reversed) Intergenic
900640269 1:3685093-3685115 TGGGGTTGGGAGGTGGCTTCTGG - Intronic
900796781 1:4712740-4712762 GAGGGCTGGGAGCGTGACTCGGG + Intronic
902218595 1:14950324-14950346 GAGGGATGGGAGGGTCCGTTTGG + Intronic
902394557 1:16125438-16125460 GAGGGTGGAGAGGGTGCCTTGGG + Intronic
902561279 1:17279171-17279193 GAGGGTGGGGTGGCTGCTTGTGG - Intronic
904036399 1:27561339-27561361 GAGTGTTGGGGGGGAACTTCAGG + Intronic
905279422 1:36839505-36839527 GAGGCTGGGGAGGGGGCTTCAGG - Intronic
905300843 1:36985360-36985382 GCTGGTAGGGAGGGTGCTCCAGG - Intronic
905665048 1:39758582-39758604 CAGGGTTATGAGGCTGCTTCTGG + Exonic
905683683 1:39893327-39893349 GGGGGAAGGGAGGGTGTTTCTGG - Intergenic
905921209 1:41720121-41720143 GAGGGTGGGGAGGATGTTTGAGG - Intronic
906291340 1:44621480-44621502 GAGGGAGGGGAGGTTGCTACTGG - Intronic
906420029 1:45657920-45657942 GACTTTTGGGAAGGTGCTTCTGG - Intronic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
911072434 1:93842806-93842828 GAGGGTTGGATGGGTCCTTATGG - Intronic
911661263 1:100504053-100504075 GAGGGCAGGGATGGTGCCTCTGG + Intronic
911949326 1:104153185-104153207 GAGGATTGGGAGAATGCTCCAGG + Intergenic
912500966 1:110121663-110121685 GATGGTTGGGAAGGGGGTTCAGG - Intergenic
912512960 1:110200929-110200951 CAGGGCCGGCAGGGTGCTTCGGG + Exonic
914984327 1:152443063-152443085 GTGGGTTTGGATGGTGCTTCTGG + Intergenic
915200936 1:154228119-154228141 GGGGGTTGGGGGGGTGGTTCTGG + Intronic
915922282 1:159985420-159985442 GGGAGTTGGGAGGTTTCTTCTGG - Intergenic
917511915 1:175675825-175675847 AGGGGTGGGGAGGGGGCTTCTGG + Intronic
919779468 1:201212907-201212929 AAGGGTGGGGAGGGTGCACCAGG + Exonic
919921100 1:202166916-202166938 GAGGGCTGGGAGTGGGCTACAGG + Intergenic
920148403 1:203883177-203883199 GTGTGTTGGGAGGGTTCTTCTGG + Intergenic
921908306 1:220519275-220519297 GATGGTTGGGAGAGAGCTTGTGG - Intergenic
922800816 1:228364066-228364088 GTGGCTGGGGAGGGTGCATCAGG - Intronic
924161840 1:241241033-241241055 GAGGGTTGGGAGGGTGAACCTGG - Intronic
1065288814 10:24210069-24210091 GAGGGTGGGGCGGGTGGTCCAGG - Intronic
1065367961 10:24952993-24953015 GAGGGCTGGGACGGTGGATCTGG - Intergenic
1065455535 10:25903120-25903142 CAGGATTGGGAGGGTGAATCAGG - Intergenic
1065944893 10:30597313-30597335 GAGGGTTTACAGGGTGTTTCTGG + Intergenic
1067332439 10:45334443-45334465 GAGGATTGGGAAGGTGCTCTTGG - Intergenic
1067705214 10:48601595-48601617 GAGGGTGGAGTGGGTGCTTATGG - Intronic
1068747305 10:60547634-60547656 GAGGGTGGGGAGGGTGGTGGTGG + Intronic
1069678891 10:70269755-70269777 GAGGGTTGGGAGGCTGAGGCAGG - Intronic
1070086740 10:73245336-73245358 GAGAGTTGGGGGGGTGGTTCAGG - Intronic
1070917052 10:80161666-80161688 CAGAGTTGGGAGGGTCCTTCGGG - Intronic
1071661195 10:87504823-87504845 GCGGGTCTGGAGGGCGCTTCCGG - Intergenic
1073325660 10:102643057-102643079 AAGGGAGGGGAGGGCGCTTCGGG - Intergenic
1073594203 10:104784275-104784297 GTGGGGTGGGAGGGTGCTCCTGG + Intronic
1074142447 10:110685747-110685769 GAGGGTCGGGAGGTGGGTTCGGG + Intronic
1074441329 10:113479655-113479677 GACGGTTGGGAGGGTGGAACGGG + Intergenic
1074708175 10:116154569-116154591 AGGAGTTAGGAGGGTGCTTCTGG + Intronic
1074907675 10:117879339-117879361 GAGGATGGGGAGGATGTTTCTGG - Intergenic
1075019939 10:118944389-118944411 GAGGCATGGGAGGGTTCTTATGG + Intergenic
1075121664 10:119669079-119669101 GAGGCTGGGGAGGGGGTTTCTGG + Intronic
1075686433 10:124368031-124368053 CAGGGCTGGGCGGGGGCTTCTGG - Intergenic
1076107648 10:127835924-127835946 GGGGGCAGGGAAGGTGCTTCCGG + Intergenic
1076335902 10:129706288-129706310 CAGAGTTGGGACGGTGCTCCCGG + Intronic
1076851650 10:133096214-133096236 CAGGCTGGGGAGGGGGCTTCAGG - Intronic
1077013842 11:391428-391450 GAGGCTTGGGAGGCTGCCTCAGG - Intergenic
1077214054 11:1387918-1387940 GAGGGTTGGGAGAGGGATGCAGG + Intergenic
1077339258 11:2018712-2018734 GAGGGGTGGCAGGGTCCCTCTGG - Intergenic
1080093814 11:28380412-28380434 AAGTGTTGGGAGGGTGAGTCAGG - Intergenic
1081575904 11:44318353-44318375 CTGGGTTGGGAGGGGGCTTCTGG + Intergenic
1082029349 11:47593618-47593640 GAGGTGTGGGAGGGTGTGTCAGG + Intronic
1082801242 11:57416426-57416448 GAGGGTTGGGAAGATGCCTAAGG + Intronic
1083485227 11:62979366-62979388 GAGTGTTGGGAGGGGCCTTTGGG + Intronic
1083597128 11:63923318-63923340 GAGGGTTGGGAGTGGGGTACGGG - Intergenic
1083700003 11:64470027-64470049 GAGGATTGGGAGGAGACTTCAGG - Intergenic
1083902377 11:65649892-65649914 GAGGGGTTGGGGGGTGCTCCTGG + Intronic
1084376571 11:68782274-68782296 GAGGGGAGGGAGGGTGTGTCAGG - Intronic
1084961200 11:72717593-72717615 GAGGGTGTGGAGCTTGCTTCAGG - Intronic
1084979824 11:72823052-72823074 TTGGGTTGGGAGGGGGCTTGAGG + Intronic
1085215046 11:74822069-74822091 GAGGGTGGGAAGGGTCTTTCAGG + Intronic
1085522414 11:77146347-77146369 CAGGGTCAGGAGGGTGCCTCAGG + Intronic
1085644226 11:78212889-78212911 GAGGGGGAGGAGGATGCTTCGGG + Intronic
1085998336 11:81949745-81949767 GAAGGGTGGGAGGGTGATTAGGG - Intergenic
1088786431 11:113186364-113186386 GAGGGTTGGGAGGTGGTTTTGGG - Intronic
1089696559 11:120219496-120219518 GAGGGTGGGGAGGGAGCCCCTGG - Intronic
1202822242 11_KI270721v1_random:73894-73916 GAGGGGTGGCAGGGTCCCTCTGG - Intergenic
1091563244 12:1630132-1630154 GAGGGGGCGGCGGGTGCTTCGGG - Intronic
1092144435 12:6204839-6204861 GTGGATTGGGAGGGTCCTCCTGG - Intronic
1092784306 12:12013851-12013873 GGAGTTTGGGAGGGTGCCTCAGG - Intergenic
1093532102 12:20177840-20177862 GAGGCTGGGGAGGGTGTTGCAGG + Intergenic
1093592562 12:20921052-20921074 GAAGGTTGGGAGGGTGGTGAAGG - Intergenic
1094473662 12:30825203-30825225 GAGGGAAGGGAGGGTCTTTCTGG + Intergenic
1094719104 12:33044258-33044280 GGGGGTTGGGGGGATGCTTTTGG + Intergenic
1095194133 12:39292839-39292861 GAGGGTTGGGAGGGTGCTTCTGG - Intergenic
1095905951 12:47378136-47378158 GAGGGTTGGGAGAGCGCTACTGG + Intergenic
1096110660 12:49027213-49027235 GGGGGCGGGGAGGGTTCTTCAGG + Exonic
1096742527 12:53704388-53704410 CAGGGTTGGGAGAGAGATTCTGG + Intergenic
1100581168 12:95942376-95942398 GAGGGGTGGGAGGGGGCATGCGG + Intronic
1101005433 12:100397012-100397034 GAAGGTTGGTAGGGGGCTTTGGG - Intronic
1101425084 12:104581616-104581638 GAGGGTGGGGAGGGTCTTTCTGG + Intronic
1101993151 12:109504250-109504272 GCTGGTTGGGAAGGTGCTACTGG - Intronic
1102101444 12:110281538-110281560 GAGGGGAGGGAGGGTGGGTCAGG + Intronic
1102490513 12:113287416-113287438 GAGGGTTGGAAGGGCCTTTCAGG + Intronic
1103193362 12:119021135-119021157 GAAGGGTGAGGGGGTGCTTCTGG + Intronic
1104803668 12:131571501-131571523 GAAGGCTGGGAGGGTCTTTCCGG - Intergenic
1105837560 13:24224297-24224319 GAGGGGTGGGAGGCTGCTCAGGG - Exonic
1107110940 13:36697622-36697644 GAGGAATGGGAGTGTGCTTGTGG - Exonic
1107974961 13:45679952-45679974 GAGGCTGGGGTGGGTGCTTTGGG + Intergenic
1110291662 13:73814761-73814783 GGGGATAGGGAGGGTGCTACTGG + Intronic
1112238933 13:97661855-97661877 AAAGGTGTGGAGGGTGCTTCAGG + Intergenic
1112239111 13:97663644-97663666 AAAGGTGTGGAGGGTGCTTCAGG + Intergenic
1112277894 13:98037720-98037742 GCAGGTGGGGAGGGTGCTCCAGG + Intergenic
1113574122 13:111382349-111382371 GATGGTTGGGGGGCTGTTTCAGG + Intergenic
1113812493 13:113151040-113151062 GAGGTGTGGGAGGGAGCCTCGGG + Intergenic
1114533554 14:23409732-23409754 GGGGGCTGGGAGGGTGTTCCTGG - Intergenic
1116289760 14:43018359-43018381 GGAAGTTGGGAGGGGGCTTCAGG + Intergenic
1117210767 14:53496515-53496537 GAGTGTTGGGAGGCTGATCCAGG - Intergenic
1118383529 14:65237099-65237121 GAGGGGAGGGAGGGAACTTCTGG + Intergenic
1119818333 14:77591316-77591338 GAGGGTGGGGAGGGTGGATGAGG + Intronic
1120192624 14:81452943-81452965 GAGAGTTGGGAGGGTGGGGCAGG + Intergenic
1120871916 14:89345605-89345627 GAAGGTTGGGAGGGGGATTAAGG - Intronic
1121320854 14:92990922-92990944 GGGGGACGGGTGGGTGCTTCGGG - Intronic
1121642856 14:95497614-95497636 GAGGGTTGGCAGACTGTTTCTGG + Intergenic
1121748591 14:96324900-96324922 GAGGGGTGGGAGTGTGGTTGCGG + Intronic
1121833136 14:97069103-97069125 AAGGGTGAGGAGGGGGCTTCAGG + Intergenic
1122228803 14:100294872-100294894 CCAGGGTGGGAGGGTGCTTCGGG - Intronic
1122446486 14:101773364-101773386 GGAGATTGGGAGGCTGCTTCAGG + Intronic
1122486756 14:102087127-102087149 GCGGCTGGGGAGGGTTCTTCCGG - Intronic
1122769527 14:104091820-104091842 GAGGGCCGGGAGGGAGCTTTGGG + Intronic
1122864460 14:104597252-104597274 GAGGGTCCGGGGGGTGCTGCTGG - Intronic
1123034841 14:105467675-105467697 GATGGCTGGGAGGGTGCCCCAGG - Intronic
1123058688 14:105584604-105584626 GAGGGGCGGGAGGGTACCTCGGG - Intergenic
1123083015 14:105704830-105704852 GAGGGGCGGGAGGGTACCTCGGG - Intergenic
1123171338 14:106375374-106375396 GAGGGTGAGGAAGGTACTTCTGG - Intergenic
1123804892 15:23860656-23860678 GAGGGCTGGGAGGGGGGATCAGG + Intergenic
1126344355 15:47676929-47676951 GTGGGGTGGGTGGGTGGTTCCGG + Intronic
1126736331 15:51735394-51735416 TAGGGGTGGGAGAGTGCTACTGG + Intronic
1128136624 15:65268397-65268419 GTGGGTTGGTTGGGTGGTTCTGG - Intronic
1128149998 15:65356690-65356712 GAGGGTTGGGGGGGTGGGTGGGG + Intronic
1128383901 15:67133614-67133636 AAGGGTTGGGAGGATGTTTCAGG + Intronic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1129868081 15:78924109-78924131 GAGGGTGGGCAGGGTGGGTCAGG + Intronic
1130073800 15:80671360-80671382 GAGGCTGGGGAGAGTGCTTTGGG - Intergenic
1132091063 15:98948323-98948345 GAAGGTGGTGAGGGCGCTTCCGG - Intronic
1133015551 16:2937918-2937940 AGGGGTTGGGAGAGTCCTTCAGG + Intronic
1133242079 16:4420790-4420812 GGGGGTTGGGGGGATGCTGCTGG - Intronic
1133250249 16:4476169-4476191 GAGGTGTGTGAGGGTGCCTCAGG - Exonic
1133833150 16:9342753-9342775 GAAGGTTGGGAGTTTCCTTCTGG + Intergenic
1134237739 16:12480775-12480797 GAGGAGTGGGAGGGTTTTTCTGG + Intronic
1134666672 16:16023836-16023858 GTGGGGTGGGAGGGTGCTCCTGG + Intronic
1134903300 16:17958073-17958095 GAGCGTTAGGAGAGTGATTCTGG + Intergenic
1135422368 16:22313852-22313874 GACTGTGGGGTGGGTGCTTCTGG - Intronic
1136271100 16:29148764-29148786 GCGGGTTGGGCAGGTGCTTGTGG + Intergenic
1137078762 16:36014999-36015021 GAAGTTTCCGAGGGTGCTTCTGG - Intergenic
1138183533 16:54959515-54959537 CAGGGATGGGAGGGTGGCTCTGG - Intergenic
1138227530 16:55310319-55310341 TGGGGTTGGGTGGGTGCTGCTGG + Intergenic
1138480206 16:57297643-57297665 GTGGGTTAGGAGGGTGGTTTTGG + Intergenic
1139648264 16:68347509-68347531 GAGGGCAGGGAGGGTTGTTCAGG + Intronic
1139659570 16:68411510-68411532 GAGGGATGGGAGGGTGATGGAGG + Intronic
1139909889 16:70391224-70391246 GAGGGTCTGGAGGGTGCTTTGGG + Intronic
1140141822 16:72265465-72265487 GAGGGGTGGGATGGGACTTCTGG + Intergenic
1142074716 16:88110769-88110791 GCGGGTTGGGCAGGTGCTTGTGG + Intronic
1142508553 17:380825-380847 GAGGGATGAGGGGGGGCTTCCGG - Intronic
1143752281 17:9037108-9037130 GGGGGTTGGGAGGAGCCTTCTGG - Intronic
1143899030 17:10159534-10159556 GAGGTTGGGGGGGGTGCATCTGG - Intronic
1143988577 17:10937111-10937133 GGGGGTGGGGATGGGGCTTCAGG - Intergenic
1144261124 17:13521942-13521964 GAGGGAAGGGAGGTTGCTACTGG - Intronic
1145911358 17:28545185-28545207 GAGGATGAGGAGGGTGCTGCAGG - Intronic
1146918975 17:36697155-36697177 GAGGCTGGGGAGGGTGCTGGGGG + Intergenic
1147121437 17:38337566-38337588 GATGGTTGGGAGGGTACATCTGG - Intronic
1147659059 17:42107579-42107601 GAGGGGCGGGAGGGGGCTTCGGG - Intronic
1147845159 17:43399561-43399583 GAAGGATGGGAGGGTGATTTAGG + Intronic
1147991112 17:44334017-44334039 GAGGGCTGGGAGGGAGGATCAGG + Intergenic
1148116106 17:45176034-45176056 AAGGGTTGGGAGGTGGCCTCAGG + Intergenic
1148279723 17:46338523-46338545 GAGGTTTGGAAGGGTCCTTGTGG + Intronic
1148301941 17:46556379-46556401 GAGGTTTGGAAGGGTCCTTGTGG + Exonic
1148897331 17:50846418-50846440 GAGGGTTGGGAGGATTCAACCGG - Intergenic
1149014442 17:51891694-51891716 GAGGGTTGGTATGGTGGCTCAGG + Intronic
1149449654 17:56739728-56739750 GAGGGATGGGAGGCTGATTTAGG - Intergenic
1151596677 17:75082222-75082244 GTGGGTGTGAAGGGTGCTTCAGG - Intergenic
1151969890 17:77452125-77452147 GCGGGGAGGGAGGGTGCTGCTGG + Intronic
1151990387 17:77570655-77570677 GAGGAGTGGGAGGCTGCTACTGG + Intergenic
1152302603 17:79503991-79504013 GCGGGGTGGCAGGGTGCTCCAGG + Intronic
1152799002 17:82322483-82322505 GAGGGCTGGGAGTGTGCCTGGGG - Intronic
1157282712 18:46356677-46356699 GAAGGTTGAGAGGGTGCCTGGGG + Intronic
1157505324 18:48222181-48222203 GAGGCTAGGGAGGGTGCAGCAGG - Intronic
1157786860 18:50491437-50491459 GAGGGTTAGGAGGGTGGTTGGGG + Intergenic
1158578610 18:58661720-58661742 TGGGGCTGGGGGGGTGCTTCTGG - Intergenic
1158624230 18:59057754-59057776 GAGGGTGGGGAAGGGGGTTCGGG - Intergenic
1160227068 18:77019775-77019797 GAAGTTGGGGAGGGTGCTTCTGG + Intronic
1160233765 18:77069134-77069156 GAGGGTTGGGAAGGTGTGTAAGG - Intronic
1160409819 18:78667907-78667929 TAGGGTTGGGAGGGTGGATGGGG - Intergenic
1160704742 19:524679-524701 GAGGGCAGGCAGGGTGCCTCAGG - Intergenic
1161569813 19:5024336-5024358 GGGGCTTGGCAGGGGGCTTCAGG - Intronic
1161850243 19:6734227-6734249 CCTGGTTTGGAGGGTGCTTCCGG + Exonic
1161967554 19:7556767-7556789 TGGGGTTGGGGGGATGCTTCCGG + Intronic
1162362142 19:10226913-10226935 GGGGGTTGGGGGGGTGACTCAGG - Intronic
1163443678 19:17334389-17334411 CGGGGCTGGGACGGTGCTTCGGG - Intronic
1163795431 19:19335172-19335194 GAGGGGAGGGAGGGGGCTCCAGG - Intronic
1165310682 19:35027824-35027846 GAGGGTTTGGAGAGTGGATCAGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166662992 19:44659335-44659357 GAGCCATGGGAGGGTGCTCCAGG - Intronic
1167575022 19:50313874-50313896 GTGGGGAGGGAGGGTGGTTCAGG + Intronic
1167768765 19:51500950-51500972 ATGGGTGGGGTGGGTGCTTCTGG + Intronic
1167769785 19:51507959-51507981 TGGGGGTGGGAGGGTACTTCTGG + Intergenic
1168432334 19:56291228-56291250 GAGGGTCAGGAGGGAGCTTGAGG - Intronic
1168651908 19:58097364-58097386 GAGTGATGGGAGGGTGAGTCAGG + Intronic
925385328 2:3458085-3458107 GAGGCTCGGGAGGGTGCTTCAGG + Intronic
926379664 2:12274134-12274156 CAGGCTTGGGAGTGTGCTTAAGG - Intergenic
928620628 2:33084381-33084403 GGGGGTTGGGAAGGTGCTGCTGG + Intronic
929811369 2:45191718-45191740 AAGGGTAGGGAGGCTGCTGCAGG + Intergenic
930975658 2:57457235-57457257 GTGGGTTGGGTGGGTGCTCTGGG + Intergenic
931615594 2:64153465-64153487 CAGGGTTGGGAGAGAGCTTAGGG + Intergenic
934990957 2:98921244-98921266 GAGGGCTGGGTGGGACCTTCTGG - Intronic
936037087 2:109121761-109121783 TAGGGTTGGGGGTGTGCATCTGG - Intergenic
936344674 2:111666265-111666287 GAGGGTGGTGAGGATGCTGCTGG + Intergenic
937837915 2:126492630-126492652 GGGGGTTGGCGGGGAGCTTCTGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938730543 2:134143625-134143647 GAGGGGTGGAAGGGTGGTGCTGG + Intronic
938817577 2:134919265-134919287 GGGGGTTGGGAGTGTGGCTCAGG + Intronic
939273176 2:139966426-139966448 GGTGGATGGGAGGGAGCTTCAGG - Intergenic
939870421 2:147520464-147520486 GAGGGCTGGGAGGAAGTTTCAGG - Intergenic
940014510 2:149089330-149089352 AAGGATGGGGAGGCTGCTTCTGG + Intronic
940711434 2:157167131-157167153 GAGGGATGGGAGGAAGCATCCGG - Intergenic
940883269 2:158968369-158968391 GAGGGATGGTAGGGTGCTTCAGG + Intergenic
940910052 2:159202576-159202598 GAGGGTGGGGAGGATGCATGGGG - Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941831630 2:169967348-169967370 GATGGTTGGTTGAGTGCTTCAGG + Intronic
944770801 2:202912453-202912475 GGGGGTTGGGAGGTAGCGTCCGG - Intronic
944945219 2:204676519-204676541 GAGAGTTGGAAGGGATCTTCAGG + Intronic
946414874 2:219534933-219534955 GGGGGTTGGGAGGGTGCTGGGGG + Intronic
946644953 2:221823400-221823422 GAGGATTGAGAGGCAGCTTCAGG + Intergenic
947825818 2:233105452-233105474 GTAGCTTGGGAGGGTGCTCCGGG - Intronic
947957012 2:234200981-234201003 GAGGGTTGGCAGGGACCTTCAGG + Intergenic
948178167 2:235960109-235960131 GGGGGCGGGGAGGGTGCTTGCGG + Intronic
948921404 2:241067666-241067688 CAGGCTTGGGAGGGTGCTGGGGG - Intronic
1168901733 20:1370682-1370704 GTGGGTTGGGAGGGTTACTCGGG + Intronic
1168987770 20:2064979-2065001 AAGGTTGGGGAGGGTGCTGCTGG - Intergenic
1169266458 20:4170154-4170176 GCGGGGTGGGGGGGTGCTTCTGG + Intronic
1170601974 20:17848315-17848337 GAGGTTTTGAAGGGAGCTTCTGG - Intergenic
1170608897 20:17895485-17895507 GGGGGTGGGCAGGGAGCTTCTGG - Intergenic
1170965490 20:21066260-21066282 TAGGGTGGGGAGGATGCTACTGG + Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1172114059 20:32563259-32563281 GAGGGTGGGGAGGGAGACTCGGG + Intronic
1172201027 20:33126013-33126035 CAGTGTTGGGATGGTGATTCAGG + Intergenic
1172768353 20:37363007-37363029 GAGGGTGGGGAGTGTGATCCAGG - Intronic
1172798063 20:37556901-37556923 GGGGGTGGGGACAGTGCTTCAGG - Intergenic
1173284271 20:41656098-41656120 GAGGGTAGGGAGAATGCTTAAGG - Intergenic
1174455893 20:50648520-50648542 GGGGGTTGGGTGGGTGGTTTTGG + Intronic
1175058132 20:56216750-56216772 CAGGGTTGAGAAGGTGGTTCTGG + Intergenic
1175521843 20:59606747-59606769 GAGGGTTGGGCAGGTGGTGCCGG + Intronic
1175527791 20:59647458-59647480 GAGGTTGGGGAGGGTGGTGCAGG + Intronic
1176097792 20:63352280-63352302 GAGGGTTGGGAGGGAGGTTGAGG - Intronic
1176254079 20:64141484-64141506 GAGGGCAGGGAAGGTGCTGCAGG + Intergenic
1176254107 20:64141548-64141570 GAGGGCAGGGAAGGTGCTGCAGG + Intergenic
1177864182 21:26493187-26493209 GAGGTTTGGGTGGGGTCTTCTGG + Intronic
1178407454 21:32336239-32336261 GAGGGTTGGGAGATAGCTTCTGG + Intronic
1178845704 21:36172354-36172376 GAGGGTTTGGATGGTGCTGGAGG + Intronic
1179654670 21:42837769-42837791 GAGGGTGGGGAGGGCGCTCTGGG - Intergenic
1179988330 21:44932981-44933003 GAGGGCGGGGAGGGCGCTCCTGG + Intronic
1179995153 21:44970849-44970871 GAGGGTTGGGAGGGGCCGTGGGG - Intronic
1180178988 21:46109586-46109608 GAGGCTTGGGGGGGTGCTGAGGG - Intronic
1180991842 22:19941756-19941778 GGGGATTAGGAGGGCGCTTCCGG - Exonic
1181164921 22:20978030-20978052 GAGGGGTGGGAGGGAGTCTCAGG + Intronic
1181406003 22:22685625-22685647 GAGGGTAGGCAGGGTGTATCTGG - Intergenic
1181532238 22:23523194-23523216 GAGGGTGGGGGGCGTCCTTCAGG - Intergenic
1181803256 22:25360635-25360657 GAGGGGAGGGAGAGAGCTTCAGG - Exonic
1181962178 22:26630138-26630160 AAAGGCTGGGATGGTGCTTCTGG + Intronic
1181978887 22:26752309-26752331 CAGGGTTGGGGGGGTGGGTCAGG - Intergenic
1182656592 22:31895182-31895204 GAGGGCAGGGTGGGTGCTACTGG + Intronic
1183061399 22:35338493-35338515 GAGGTTAGGGAGGGTGTTGCTGG - Intronic
1184108578 22:42382620-42382642 GAGGGGTGGCAGGGAACTTCAGG - Exonic
1184264004 22:43337083-43337105 GAGGCTTGTGAATGTGCTTCGGG - Intronic
1184341900 22:43890886-43890908 GAGGGTCGGCAGGGTGGGTCTGG - Intronic
1185359488 22:50397013-50397035 GAGAGTGGGGAGGGGTCTTCTGG + Intronic
1185409084 22:50673382-50673404 GCGGGTTGGGAGAGTTCTGCAGG + Intergenic
949621993 3:5823615-5823637 GAGGGTTGTGAGGTGACTTCTGG - Intergenic
950136787 3:10586710-10586732 GAGGGGTGAGAGGGAGCATCTGG + Intronic
950579346 3:13852422-13852444 GCCTGTTGGGAGGGGGCTTCTGG + Intronic
950610010 3:14120463-14120485 GAGGGAAGGGAAGGTGCTCCTGG - Intronic
952491926 3:33881761-33881783 GGAGTTTGGGAGGGTCCTTCAGG - Intergenic
953178475 3:40574163-40574185 GAGGGGTGGGAGCCTGCTTGTGG + Intronic
953413077 3:42701135-42701157 GAGGGTGGGGCCGGTGCCTCTGG - Intronic
953488626 3:43327653-43327675 CAGGGTGGGGAGGGGACTTCAGG - Intronic
954065714 3:48104316-48104338 TAGGGTTTAGAGAGTGCTTCAGG - Intergenic
954108843 3:48423233-48423255 GTGGATTGGGAGGGTGTTTGGGG - Intronic
954117422 3:48474890-48474912 CATGGTGGGGAGGGTGCTCCTGG - Intronic
960715513 3:120571202-120571224 GAGGTTTGGGAAGATGCTTTTGG - Intergenic
961768631 3:129231836-129231858 GAGGGGGTGGAGGCTGCTTCAGG + Intergenic
961820845 3:129574962-129574984 GAGGGCAGGGAGGGTTCTCCAGG + Intronic
967597797 3:191348208-191348230 GAGGGGTGGTTGGGTGCTTTGGG + Intronic
968289016 3:197524742-197524764 GGGGGTTGGGGGGATGCTTGAGG + Intronic
968495123 4:911057-911079 GTGGGTTGGGGTGGTGCTTTCGG - Intronic
968936430 4:3612724-3612746 GAGGGTGGGGAGGGAACTTCAGG + Intergenic
970192377 4:13528861-13528883 GGGGGTTTGGGGGGTGTTTCGGG - Intergenic
971372872 4:26032381-26032403 GAGGGTGAGGAGGCTGCTTCGGG - Intergenic
977210109 4:94208455-94208477 GAAGGTTGAGGGGTTGCTTCGGG - Exonic
978566241 4:110085237-110085259 GAGGGATGAGAGGCTGCTTCTGG + Intronic
981239162 4:142454370-142454392 AGGGGTTGGGAGGGTGCATAGGG - Intronic
981669249 4:147267888-147267910 GAGGGTTGGGAGAGTGATTGGGG - Intergenic
982720021 4:158849540-158849562 GAGATGTGGGAGGGGGCTTCTGG + Intronic
984608603 4:181812938-181812960 GTGGGTTGGCTGGGTGCCTCAGG - Intergenic
985528949 5:422516-422538 GACGGGTGGGCGGGTGCTCCAGG + Intronic
985838348 5:2287572-2287594 GAGGGATGAGAAGATGCTTCTGG + Intergenic
986785339 5:11109025-11109047 GAGGGCAGAGAGGGTCCTTCTGG + Intronic
990961788 5:61401223-61401245 GGGGGTTGGGATGGTGGTGCTGG + Intronic
991023694 5:62007662-62007684 GAGGGTGGGGTGGTTGCTACTGG - Intergenic
994843953 5:104961379-104961401 GTGGGTTGGGAGGGAGCATGAGG + Intergenic
996308717 5:122078637-122078659 GGAGGTTGGGAGGGTGCTGGGGG + Intergenic
997211784 5:132081160-132081182 AAGGGTTGACAGGGAGCTTCTGG + Intergenic
997622144 5:135305813-135305835 GAGGGTGGGGAGGGTGTTGCTGG + Intronic
998020692 5:138767454-138767476 GAGGGCAGGGAGGCTGTTTCAGG - Intronic
998134578 5:139668074-139668096 GAGGTTGGGGAGGGTGCCGCAGG - Intronic
998200795 5:140117935-140117957 AAGGTTTGGGAGGGTGCTTGGGG - Exonic
998377881 5:141702905-141702927 GGGGGTGGGGAGCGGGCTTCGGG + Intergenic
998588028 5:143448691-143448713 TGGGGCTGGGAGGGTGCTACTGG + Intergenic
999184993 5:149700629-149700651 GATGGGGGGCAGGGTGCTTCTGG + Intergenic
999238487 5:150114106-150114128 GAGGGTTGGGAAGGGGGTGCAGG - Exonic
999390627 5:151186954-151186976 AAGGGTAGGAAGGGTGCCTCAGG - Intronic
999441945 5:151608360-151608382 GAGGCTGGGCATGGTGCTTCAGG - Intergenic
1002400508 5:178989212-178989234 GAGGGTGGGGAGGGTGGTGAGGG - Intronic
1002478600 5:179484619-179484641 GAGGACTGGGAGGGCGCCTCGGG - Intergenic
1003085297 6:3055610-3055632 GGGGGTTGGGAGGGCGGTGCTGG + Intergenic
1003324874 6:5084396-5084418 GTGGGCGGGGAGGGTGCTTGGGG + Intergenic
1003893022 6:10580305-10580327 GAGGATTGGGTGGGGGCTGCTGG - Intronic
1005766501 6:29016486-29016508 AAGGGTCGGGATGGTGCTTGAGG + Intergenic
1005917323 6:30364677-30364699 GAGGGTGAGGAGGGTGGATCAGG - Intergenic
1006191524 6:32212630-32212652 GAGGGGTGGGAGGGAGCGTGAGG + Intronic
1006521357 6:34572982-34573004 GAGGGTTGAAAGGATGCTTTGGG - Intergenic
1006785933 6:36667323-36667345 GGGTGTGGGGAGGGTGTTTCAGG + Intergenic
1009511348 6:64552975-64552997 GTGGGTAGGGAGGGAACTTCTGG - Intronic
1010503738 6:76631791-76631813 GAGGCCTGGGTGAGTGCTTCTGG + Intergenic
1011359836 6:86511444-86511466 GGGGATTGGGGGGGTGCTACAGG + Intergenic
1011558827 6:88595039-88595061 GTGGGCTGGAAGGGTGCTTATGG - Intergenic
1018264402 6:162006737-162006759 GAAGGGTGGGAGGCTGCTTTAGG - Intronic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1019522733 7:1468012-1468034 GAGGATGGGGAGGGTGCTGAGGG - Intergenic
1021021167 7:15600104-15600126 GAGGGCTGAGAGGGTGCTGATGG - Intergenic
1021860564 7:24901731-24901753 CAGGGTTGACAAGGTGCTTCTGG + Intronic
1023625234 7:42108921-42108943 CAGGGGTGGGAGGGTGTTTCAGG - Intronic
1024097656 7:45997418-45997440 AAGGCTTGGGAGAGTGCTCCAGG + Intergenic
1026018750 7:66692694-66692716 GAGGGGTGGGTGGGAGCTTTAGG - Intronic
1026682120 7:72474904-72474926 GACTGTTGAGAGGGTGTTTCAGG - Intergenic
1026881656 7:73910000-73910022 GAGGGGTGGGTGGGAGCTTTAGG + Intergenic
1027669704 7:81080743-81080765 GAGGATTGAGATGGTGTTTCAGG + Intergenic
1029446797 7:100617805-100617827 AAGGGTTGAGAAGGTGCTTTGGG + Intergenic
1031586003 7:123533004-123533026 GGGGGTTGGGAGGTAGCGTCCGG + Intronic
1032923888 7:136579983-136580005 AGGGTTTGTGAGGGTGCTTCTGG + Intergenic
1033820603 7:145130250-145130272 GGGGGTTGGGGTGGTGCTACTGG - Intergenic
1033943246 7:146681519-146681541 GAGGGGTGGGAGGGTGGTGGGGG + Intronic
1034053634 7:148011495-148011517 GAGGGTTTAGAGGGTTTTTCTGG + Intronic
1034412030 7:150946898-150946920 GAGGGTGGGGAGGGGGCTGACGG + Exonic
1035202402 7:157276079-157276101 GAGGGGGGCGAGGGTGCTGCAGG - Intergenic
1036125559 8:6058760-6058782 AGGGGTTGTGAGGATGCTTCTGG - Intergenic
1037294153 8:17383128-17383150 CAAGGTTGGGAGGATGGTTCTGG + Intronic
1038308057 8:26422275-26422297 AAGGGTATGGAGGGAGCTTCTGG - Intronic
1038607649 8:29024949-29024971 GGGGGTAGGGAGGGTGGTTTAGG - Intronic
1039574640 8:38613380-38613402 TAGGGCTGGGAGGGTGCTGAAGG - Intergenic
1039837082 8:41265132-41265154 CAGGGTGGGGAGGGAGCCTCGGG - Exonic
1040746196 8:50645035-50645057 GAGGGATGGCAGGGTGGCTCAGG - Intronic
1040947168 8:52895488-52895510 GTGAGGTGAGAGGGTGCTTCAGG - Intergenic
1041978171 8:63823603-63823625 GAGGGTTGGGGGAGTGCCACTGG - Intergenic
1044653252 8:94521186-94521208 GAGGGTTGGGGGAGAGCATCAGG - Intronic
1045500020 8:102738064-102738086 GGGGTTTGGGAGGGAGGTTCTGG + Intergenic
1046011807 8:108557503-108557525 GGGGGATGGGAGGGTGGTTGGGG + Intergenic
1046747316 8:117890353-117890375 GGGGAATGGGTGGGTGCTTCTGG + Intronic
1046757653 8:117988631-117988653 TGGGGTTGGGAGGGTGCTGGAGG - Intronic
1048294948 8:133207175-133207197 GAGGGTTGGGAGGGGCCTCATGG - Intronic
1049110252 8:140637722-140637744 GAGGGTAGGGATGGGGCTGCAGG - Intergenic
1049633706 8:143674119-143674141 GAGGGTTGGGAGGGAAGTGCAGG - Intergenic
1049747417 8:144268883-144268905 GAGGGTGAGGAGGGCGCTGCAGG + Intronic
1051287053 9:15508515-15508537 GAGCGTGGGGAGGGTGATTTGGG + Intronic
1053455123 9:38227521-38227543 GGGGGTTGGGAGGGAGGTTAAGG + Intergenic
1054730950 9:68702565-68702587 ATGAGTTGGGAGGGTGGTTCTGG + Intergenic
1055353196 9:75410984-75411006 AAGGAGTTGGAGGGTGCTTCTGG + Intergenic
1055688027 9:78798796-78798818 GAGGGTGGGGAGGGAGGTTCGGG + Intergenic
1057229192 9:93308596-93308618 GCGGGTGGGGCGGGTGCTCCTGG + Intronic
1058190483 9:101908761-101908783 GAGGGTTGGGAAGATGGTTTTGG + Intergenic
1059461491 9:114433425-114433447 CAGGCTTGGGAGGGTGCTGAAGG - Intronic
1060966402 9:127714562-127714584 CAGGGTTGGGATAGGGCTTCAGG - Intronic
1060982942 9:127803859-127803881 GAGGGTTGGGGTGGAGCTTCGGG + Intronic
1061389916 9:130311754-130311776 GAGGGTGGGGAGGGGGCAGCAGG + Intronic
1061766905 9:132887275-132887297 GGGAGTAGGGTGGGTGCTTCTGG + Intronic
1062348944 9:136129454-136129476 GCGGGATGGGAGGGTGTTTCCGG - Intergenic
1062376784 9:136265402-136265424 GGGGGCTGGGAGGGTGGTGCAGG - Intergenic
1187574543 X:20540696-20540718 GAGGGGTGGGAGGGTGATTGGGG - Intergenic
1188893518 X:35638572-35638594 GAGGCTTAGGAGGATCCTTCAGG - Intergenic
1192142245 X:68655651-68655673 GAGAGTTGTGAGGTGGCTTCTGG + Intronic
1192237596 X:69305916-69305938 GAGGGAGGGGAGGGGGCTCCAGG + Intergenic
1198558642 X:137824430-137824452 GAGGGTTGGGTGGATGATTTTGG + Intergenic
1198681900 X:139191949-139191971 CGGGGCTGGGAGGGAGCTTCGGG - Intronic
1199895002 X:152119527-152119549 CAGGGTTGGCAGGGTGCTGGGGG + Intergenic