ID: 1095199804

View in Genome Browser
Species Human (GRCh38)
Location 12:39370226-39370248
Sequence CTTGCCAAAGAGAAGATTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095199804 Original CRISPR CTTGCCAAAGAGAAGATTGA AGG (reversed) Exonic
900709762 1:4106375-4106397 CTAGCCAAAGAGAAAAAGGAAGG + Intergenic
905403909 1:37720705-37720727 CCTACCAAAGAGAAAAGTGAGGG + Intronic
905493902 1:38369430-38369452 ATTGCCAAAGATAGAATTGAGGG - Intergenic
906805845 1:48777896-48777918 CTTGCCAAAGAGAGCCTGGAGGG + Intronic
907216482 1:52869462-52869484 TTTGCTAAACAGAAGCTTGAAGG - Intronic
909471247 1:76030824-76030846 CTTAGCAAAGAGAAGATATAGGG + Intergenic
911141405 1:94506708-94506730 CTGTCCAAAGAGAAGATTCCAGG + Intronic
911176536 1:94823112-94823134 CTTTCCAAAGGAAAGAATGATGG + Intronic
912032606 1:105267944-105267966 CTTGCCAAAGACTATGTTGAAGG - Intergenic
912655025 1:111478303-111478325 CTGGCCAGAGGAAAGATTGATGG + Exonic
915174126 1:154000617-154000639 CTGGACAAAGAGATGATTCATGG + Intronic
915498057 1:156295067-156295089 CAGGCAAAAGAGAAGCTTGAGGG + Intronic
915605333 1:156946891-156946913 CTTGGCAAGGAGGAGATTGGGGG - Intronic
916834593 1:168530756-168530778 TTTGCCAGAGTGATGATTGATGG + Intergenic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
919800220 1:201349504-201349526 CTTGCCGAACAGAAGATTTGGGG - Intergenic
920411214 1:205762427-205762449 CTTGCCAAATGGAAGATTACAGG - Intergenic
921593517 1:217030231-217030253 ATGGCCACAGAGAAGAGTGAAGG - Intronic
923919994 1:238553144-238553166 CTTGCCAAAGAAAAGGCTAAAGG - Intergenic
1062927960 10:1331639-1331661 CTATCCAAAGATAAGAATGATGG + Intronic
1063696454 10:8340089-8340111 TTTTACAAAGAGAAGATAGAAGG - Intergenic
1064174827 10:13065729-13065751 CATGCCAAAGAGAATGTTGCAGG - Intronic
1064337359 10:14456112-14456134 CTCGCCAAAGAGCAGAAAGATGG + Intronic
1064592720 10:16910972-16910994 CTAGCCCAGGAGAAGAATGAAGG + Intronic
1066253146 10:33653549-33653571 CTAGCCAATGAGCAGAGTGAGGG - Intergenic
1067567054 10:47346985-47347007 ATTTCCAAAGAGCAGATTGTGGG + Intergenic
1069038907 10:63673726-63673748 CTTTCCAAAGAGGAGAATGTTGG + Intergenic
1070716600 10:78727044-78727066 GTTTCCAGAGAAAAGATTGAGGG + Intergenic
1071122349 10:82293891-82293913 CTTGCTAAATACAAGGTTGAAGG - Intronic
1072418197 10:95266503-95266525 CTTGCCAAACAGGAAATTGCAGG - Intronic
1073733279 10:106316823-106316845 CTTGGAAAAGAGAATATTCATGG + Intergenic
1074177087 10:111018593-111018615 ATTTCTAAAGAGAAGATTTAAGG - Intergenic
1074961159 10:118447427-118447449 TTTGCTAAAGAGAAGACTGGAGG - Intergenic
1076628858 10:131840636-131840658 TTTGCCCAAGAGAAGGTTGATGG - Intergenic
1078948084 11:16094381-16094403 CCTGGCTAAGGGAAGATTGATGG + Intronic
1080305174 11:30827662-30827684 GCTGCCACAGAGAAGACTGAGGG - Intergenic
1085245982 11:75100790-75100812 CTTGCTAAAGAGAAGAATTTTGG + Intronic
1085729201 11:78982187-78982209 CTTGCCAACCAGAAGATGCAAGG - Intronic
1087119573 11:94559560-94559582 CTAGGCAAAGAGAAGGTTGTTGG - Intronic
1087728553 11:101752251-101752273 ATTGCCTAAGAGAACTTTGAAGG + Intronic
1087843671 11:102946663-102946685 ATTGCCTAAGAGAAGCTTAAGGG + Intronic
1088898033 11:114092551-114092573 CTCTCCAAAGAGAAGTTTCAGGG + Intronic
1089436576 11:118473890-118473912 GTTTCCAAAGAGAAGGTTGTTGG + Exonic
1089633541 11:119797879-119797901 CTTCCCAAAGGGAAGATGGCTGG - Intergenic
1091572934 12:1706205-1706227 CTTACCAATGAGAAGACTGAGGG - Intronic
1092609801 12:10160225-10160247 CTTGCCAGAGAGAAGCTTGGGGG - Intronic
1095199804 12:39370226-39370248 CTTGCCAAAGAGAAGATTGAAGG - Exonic
1099940870 12:89186776-89186798 CTTTTCAAAGTGAATATTGAGGG - Intergenic
1100288437 12:93190070-93190092 CTTGCCTTAGGGAAGAATGAGGG - Intergenic
1101037489 12:100719459-100719481 ATTGTCAAAGAGAAGATTTGCGG - Intronic
1101128011 12:101659328-101659350 CTTTCCCAAGAGAAAATTGGAGG - Intronic
1103926638 12:124427074-124427096 ATTTCCAAAGGGAAGATTCATGG - Intronic
1106412304 13:29519094-29519116 CTTGGGACAGAGAGGATTGAGGG - Intronic
1107106210 13:36645525-36645547 CTTGGAAAAGAGAAGACTGAAGG + Intergenic
1107413816 13:40182628-40182650 ATGGCTAAAGAGAAGATTAAGGG - Intergenic
1110104358 13:71652538-71652560 CTTGGCAAAGAGAACAGTGAAGG - Intronic
1110175698 13:72553238-72553260 CTTGAAAAAGAGAAAATTAAGGG + Intergenic
1110607350 13:77448222-77448244 CTTGCCTCAGGGAAGAATGAGGG + Intergenic
1112833358 13:103480579-103480601 CATTCCAAATAAAAGATTGAAGG - Intergenic
1113141498 13:107156698-107156720 CTTGCTAAAAAGCAGACTGAGGG + Intergenic
1114825066 14:26067285-26067307 CTTGTCAAAGAGAATATTAGAGG - Intergenic
1114927943 14:27428051-27428073 CCTGAGAAAGAGAAGATTCAGGG - Intergenic
1116104750 14:40487568-40487590 CTTGCCAAAAGGAATTTTGAGGG - Intergenic
1119749913 14:77069871-77069893 CTTGGCAAAATGAAGAGTGAGGG + Intergenic
1120006993 14:79369669-79369691 ATTGAAAAAGAGAAAATTGAGGG - Intronic
1120674826 14:87408667-87408689 ATTGCCAAAGAGAAGGGTGAGGG - Intergenic
1123838760 15:24224824-24224846 ATTGACAAAGAGAATATAGATGG + Intergenic
1123848324 15:24327196-24327218 ATTGACAAAGAGAATATAGATGG + Intergenic
1123867383 15:24534719-24534741 ATTGACAAAGAGAATATAGATGG + Intergenic
1126407952 15:48341342-48341364 TTTGGCAAAGAAAAGTTTGAAGG + Exonic
1127006255 15:54573245-54573267 CTTCCAAAAGAGAATAATGAAGG - Intronic
1127267369 15:57373139-57373161 CTTGCCAAAGAGAAGTTTCCAGG - Intergenic
1128035601 15:64522670-64522692 CTTTCCAAAGAGAAGAAAGCAGG - Intronic
1129226584 15:74173998-74174020 CTTGACTAAGAGTAGCTTGAAGG + Exonic
1129489128 15:75905767-75905789 CCTGCCAAAGACACAATTGATGG - Intronic
1129821381 15:78604322-78604344 TTTGCCAAAGAGAAAACTGACGG + Intronic
1130971128 15:88733623-88733645 TTTGCCATAGAGAAGCTTGCAGG - Intergenic
1132136498 15:99345814-99345836 CTTGCAACCGATAAGATTGAGGG + Intronic
1136556350 16:31010001-31010023 TTTGCCAAAGAGAAGCATGGGGG - Intronic
1138652624 16:58469891-58469913 CTTGCCAAAGAGCACACAGATGG + Intronic
1140901018 16:79367923-79367945 CTTTCCAAAGAGAAAATAAATGG + Intergenic
1141809027 16:86361830-86361852 CTTCCCAGAGAGATGAGTGAGGG - Intergenic
1146074910 17:29719272-29719294 ACTCCCAAAGAGAACATTGATGG - Intronic
1146837114 17:36120282-36120304 CTTGCCACAGAGCACAGTGAGGG + Intergenic
1149422773 17:56527413-56527435 TTAACCAGAGAGAAGATTGAAGG - Intergenic
1151176352 17:72291465-72291487 ATTGCCACTGAGAAGAATGAAGG - Intergenic
1154956422 18:21261411-21261433 CTTGCTTAAGAGAACATTCATGG - Intronic
1155240035 18:23856253-23856275 TTTGCCAAAGAGAAACTTAATGG + Intronic
1155766111 18:29635139-29635161 CTTGCCTCAGGGAAGAATGAGGG - Intergenic
1156681019 18:39588727-39588749 CTTGGCAAAGAGGAGACTAAAGG + Intergenic
1158055008 18:53268552-53268574 ATTGCAAATGAGAAAATTGAAGG - Intronic
1159110030 18:64044645-64044667 CTTCCCATAGCAAAGATTGATGG - Intergenic
1159535084 18:69705026-69705048 CTTCCCAAAGAGCAGAATGAGGG - Intronic
1161806752 19:6448373-6448395 CTTGCCAAATAGATGTTTAATGG + Intronic
1163352747 19:16788867-16788889 TTTACCAAAGAAAAGATGGATGG - Intronic
1164814793 19:31187941-31187963 CTTGTCAAAGAGAAGTCTGCTGG + Intergenic
1166049881 19:40252317-40252339 GTTGCCAAAGAGAAAACTGCTGG - Intronic
926615971 2:14996825-14996847 TTTGCTAGAGAGAAAATTGAGGG - Intergenic
926926070 2:17988841-17988863 CTAGCCAAAGAAAAGGGTGACGG - Intronic
928283434 2:29968554-29968576 CTGGCCAAAGAGAAGAAGGTGGG + Intergenic
930739410 2:54814575-54814597 CTTGTCAAAAATTAGATTGAAGG - Intronic
932066352 2:68566246-68566268 CCTGAGAAAGAGAAGATTTAAGG + Intronic
933061651 2:77744839-77744861 CTTGCCCAAGAAAATATGGAGGG + Intergenic
936384004 2:112012531-112012553 CATGACAAAGAGAAGATGAATGG - Intronic
936417539 2:112331151-112331173 CTTGCTAAAGAGAAAAGTAAAGG + Exonic
938635032 2:133214798-133214820 CTGGGCAAAGAGAAGACTAAGGG - Intronic
938670840 2:133584924-133584946 CTTGCCAAAAAAAAGAAAGAAGG + Intergenic
939881212 2:147633438-147633460 TTTGGCACAGAGAAGATTGTTGG - Intergenic
940391597 2:153138912-153138934 ATATGCAAAGAGAAGATTGAGGG - Intergenic
940392038 2:153143344-153143366 CTTGCAAAAGAAAGGATAGAAGG - Intergenic
940448022 2:153801032-153801054 GCTGCCAAAGAGAAGTTGGAAGG - Intergenic
941641274 2:167991381-167991403 CTGCCCAAAGAGAAGAGTAAAGG + Intronic
943002747 2:182349546-182349568 CTTTCTAATCAGAAGATTGATGG - Intronic
943264168 2:185705730-185705752 CTTGTCAAAAATCAGATTGAAGG + Intergenic
943584266 2:189719379-189719401 CATACCAAAGACAAGATGGAAGG + Intronic
944953821 2:204784799-204784821 CTTGACAAAGATGAGATTGCTGG + Intronic
945425322 2:209693794-209693816 GATGACAAAGATAAGATTGAAGG + Exonic
945924255 2:215787753-215787775 CTGGCCACGGAGAAGATGGACGG + Intergenic
948113419 2:235475037-235475059 CTTGCCGAAGATAAGATGGTTGG + Intergenic
1173929072 20:46803552-46803574 GTTGCCTAACAGATGATTGACGG - Intergenic
1174490598 20:50891693-50891715 CTTCCCAAAGCGAAGATGCAAGG - Exonic
1174892297 20:54409020-54409042 CTCGCCAAAGAAAACGTTGATGG - Intergenic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1178118102 21:29437780-29437802 CTAGCCAGAGAGAAGAATGTGGG - Intronic
1178759039 21:35382880-35382902 CTTCCGAAAGAGAAGAATGTGGG + Intronic
1180857516 22:19057834-19057856 CTTGCAAAAGAGAGGCTTGGAGG - Intronic
1183859492 22:40659424-40659446 CTGGCCAAACTGAAGAATGAAGG + Intergenic
949244517 3:1910412-1910434 CTTGCCTCAGACAAGATTGGGGG - Intergenic
949296568 3:2531385-2531407 CTAGTCAAAGAGAAGTTTGGAGG + Intronic
949811799 3:8014168-8014190 CTTGCCCAAGAGAAGATCATGGG - Intergenic
952606122 3:35148755-35148777 CTTTCCATAGAGAATATTGATGG - Intergenic
953013900 3:39054028-39054050 CCTGCTGAAGAGAAGATTCAGGG + Intronic
955312501 3:57903332-57903354 CATTCTAAAGAGAAGAGTGATGG + Intronic
955346566 3:58165982-58166004 CTTACCTGAGAGAAGATGGAAGG - Intronic
955534450 3:59908267-59908289 CTTTGCAAAGAGAATAATGAAGG + Intronic
956510718 3:69990036-69990058 CTTGTTGAAGAGAACATTGAGGG - Intergenic
956608960 3:71102592-71102614 CTTGGGAAAGAGAAGAAAGACGG - Intronic
956876905 3:73472716-73472738 GTTGCCATAATGAAGATTGAAGG - Intronic
957329921 3:78748828-78748850 CTTTCCAAAGATAAGAAAGAAGG - Intronic
959946610 3:112132218-112132240 CTTGCCGAAAAGAGGATTGGTGG - Intronic
960401268 3:117202049-117202071 CATGCCATAGAAAAGACTGAAGG + Intergenic
960655812 3:120003028-120003050 TTTGCTAAAAAGAAGATTCAGGG - Intronic
961854371 3:129854682-129854704 CTTGGCAAAGAAAGGATAGATGG - Intronic
961978256 3:131049327-131049349 ATTAGCAAAGAGATGATTGACGG + Intronic
964894084 3:161574003-161574025 TTTGCTAAAGGAAAGATTGAAGG - Intergenic
970064596 4:12077855-12077877 CTTGCAGAAGAGCAGACTGAAGG + Intergenic
970227136 4:13870893-13870915 CTTGTCAAAGAGAAGAATGAAGG - Intergenic
970923005 4:21417094-21417116 CTTGAGAAAGAGAAGAATGATGG - Intronic
972460107 4:39293873-39293895 CTTGCCAATGAGAAGAGCCATGG + Intronic
972766902 4:42159634-42159656 CATTCCAAAGAGAGGATGGAGGG - Intergenic
973744808 4:53953136-53953158 CTTTCCAAAAAGAAGACTGAGGG - Intronic
973847572 4:54928427-54928449 CTTGCCAAAGACAACACTGCTGG - Intergenic
974166380 4:58209788-58209810 TTAGTCAAAGAGAAGATTAAAGG + Intergenic
974172417 4:58282830-58282852 TTAGCCAAAGAGCAGATTCAAGG - Intergenic
974875610 4:67700303-67700325 CATGCCAAAGATAGAATTGATGG - Intronic
975240197 4:72048277-72048299 CTTACCCAAGAGAAGATTTCAGG + Intronic
975637544 4:76464981-76465003 GTAGCCAAAGAGAACATTTATGG - Intronic
976339997 4:83936287-83936309 CTTGGCTAAAAGAAGATTAATGG + Intergenic
976483960 4:85578391-85578413 CTTGCACAAAAAAAGATTGATGG + Intronic
976559311 4:86482941-86482963 CTTTCCAAAGAGCTGATTGTAGG + Intronic
976657657 4:87506228-87506250 CTTGCCAAAGATCATATAGATGG - Intronic
977412289 4:96683394-96683416 GTTGACATAGAGAGGATTGAAGG - Intergenic
977492484 4:97732226-97732248 CTTCCCAGAGAGGAGATGGAGGG - Intronic
978053360 4:104231831-104231853 CTTGCCATAGAAAATATTTATGG - Intergenic
979047211 4:115883465-115883487 CTTGCCAAAGTAGACATTGATGG + Intergenic
980008529 4:127568982-127569004 GTTGCCAAAGATTAGAATGAGGG + Intergenic
982375163 4:154682054-154682076 CTTGTGAAAGAGAAGAGTCAGGG - Intronic
982605595 4:157512986-157513008 ATAGCCAATGAGAAGAGTGAAGG - Intergenic
983584448 4:169340477-169340499 CTTATCACAGAGAAGTTTGAAGG + Intergenic
985331349 4:188839789-188839811 TTTACCAAAGAGCAGGTTGATGG - Intergenic
985690498 5:1308798-1308820 ATTGCCGAAGAAAAGATTAATGG - Intergenic
987517183 5:18926045-18926067 CTTGACAAACTGAATATTGAGGG - Intergenic
988272074 5:29030481-29030503 ATTGCCAAAGAAAAGACGGAAGG - Intergenic
989154088 5:38327405-38327427 CTTGCCAAATAGAAGAATATGGG + Intronic
989821339 5:45798134-45798156 CTACCCAATGAGAAGACTGAGGG - Intergenic
990613507 5:57483226-57483248 CTTGAAAAAGTGAAGATTGCAGG - Intergenic
991357481 5:65784037-65784059 CTTGCAAATGAGAAAACTGAGGG + Intronic
992390434 5:76326359-76326381 CTTGCCAGACAGCAGATTCAGGG + Exonic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
993156395 5:84230278-84230300 TTTGCCAAATAGAAAATTGATGG - Intronic
995555093 5:113319545-113319567 CTGGACCAAGAGAAGATGGAAGG + Intronic
997410163 5:133684905-133684927 CTTTCCAAAGAGAAGCTCCAGGG + Intergenic
997663267 5:135605873-135605895 ATTGTCAAAGAGAAGCTTGCTGG + Intergenic
997942365 5:138169634-138169656 GTTGCTAAAGAGAATATTAAAGG - Intronic
998437894 5:142128822-142128844 CTTACCAAAGTGAAAATTGGTGG + Intronic
1000956993 5:167555005-167555027 CTTTCCAGAGAGATGAGTGATGG - Intronic
1001156746 5:169278918-169278940 GTTTCCAAAGAGAAGGTTGATGG + Intronic
1001777782 5:174341895-174341917 TTTTCCAAAGAGAAAACTGAAGG + Intergenic
1002755601 6:156664-156686 CTTGCCAAAAAGAAAAGTCATGG + Intergenic
1003282918 6:4709922-4709944 CTGGCCAAAGAGATGTTTTAAGG - Intronic
1003366508 6:5479994-5480016 CTTTCCAAAGAGTAGATTATTGG + Intronic
1004822051 6:19377893-19377915 CATGCCAAACTAAAGATTGATGG - Intergenic
1005186612 6:23169542-23169564 CTAGCCCTAGAGAAGTTTGAGGG - Intergenic
1006991429 6:38218000-38218022 CTTCCTAAGGAGTAGATTGAAGG - Intronic
1007555194 6:42759942-42759964 CTTGTTAAAGAGATGATTTATGG + Intronic
1008415218 6:51232087-51232109 CTTGCCAAAGAGGAGAATTAGGG - Intergenic
1008598739 6:53067985-53068007 CTTGCCAGAGATAAGATAGGAGG + Intronic
1010275394 6:73962913-73962935 TTTTCCAAAGAGAATTTTGAGGG + Intergenic
1010541170 6:77094044-77094066 CTTGCCAATGAGGAGATTAGAGG + Intergenic
1011825628 6:91302376-91302398 CTTGCTTCAAAGAAGATTGAGGG + Intergenic
1013029632 6:106320756-106320778 CATACCAAACAGAAGACTGAGGG + Intronic
1013722818 6:113051274-113051296 CCTGACAAAGAGAGGGTTGATGG + Intergenic
1013760358 6:113510913-113510935 CTTGCCTCAGAGAAGTCTGAGGG + Intergenic
1014216269 6:118755364-118755386 AGTGCCTCAGAGAAGATTGAAGG - Intergenic
1016519331 6:144929189-144929211 CTAGCCAGAGAGAAGAGTCAGGG + Intergenic
1019155365 6:170035118-170035140 CTTTCCAAACAGCACATTGATGG + Intergenic
1020690221 7:11345668-11345690 CTTGTCAAAGAGAAATGTGATGG + Intergenic
1021881393 7:25098364-25098386 TTTGCCAGAGACCAGATTGAAGG - Intergenic
1021934317 7:25614999-25615021 CGTGCCAAAGTGAAGGCTGAGGG - Intergenic
1022276542 7:28860912-28860934 TTTGGCAAAGAGAAGATTGTGGG - Intergenic
1022309181 7:29179137-29179159 CTTGGCAAAAAGAAAATGGAGGG - Intronic
1022476541 7:30714531-30714553 ATTGGCAAAATGAAGATTGAGGG - Intronic
1022635431 7:32129547-32129569 CATGACAAAGAGAAACTTGAGGG - Intronic
1022855254 7:34307877-34307899 CTTTCAACAGAGAAAATTGAGGG + Intergenic
1022967859 7:35490296-35490318 CTTGCTACAGAAAATATTGAAGG - Intergenic
1024133486 7:46382260-46382282 CTTGCAAAAGAAAAAGTTGAAGG + Intergenic
1024992177 7:55243826-55243848 GTTGCCAATGAGAAAATTCAAGG + Intronic
1027958494 7:84913532-84913554 CTTGCACAAGAGAGGATTCAGGG - Intergenic
1028399753 7:90412312-90412334 ATTGACAAAAAGAAGATTGAAGG + Intronic
1029866035 7:103630080-103630102 CTTCCCAGAGAGAAGATGTATGG - Exonic
1030629771 7:111883236-111883258 CTTGCCAGGGATGAGATTGAGGG - Intronic
1031073260 7:117186239-117186261 TATGCCAAAGAGAAGATGTAAGG - Intronic
1032693402 7:134312308-134312330 CTTGTTAAAGAGAACATAGAAGG - Intronic
1033630419 7:143152492-143152514 CATGCCAAAGAAAACATTGTTGG + Intergenic
1035398228 7:158548931-158548953 CTTGCCAAGGAGGAGATGGGTGG - Intronic
1035831069 8:2694806-2694828 ATTGCCCAAGACTAGATTGAAGG + Intergenic
1037745438 8:21640464-21640486 CTTTACATAGAGCAGATTGATGG + Intergenic
1037766440 8:21775190-21775212 CTTCCCAAAGTGAAGAGTGCAGG + Intronic
1039846033 8:41326192-41326214 CTTGTCAAAGAAAAGGTTGCTGG + Intergenic
1040606551 8:48938647-48938669 CTTGCAAAAGGAAGGATTGAAGG + Intergenic
1041553317 8:59124418-59124440 CTTACCACAGAGATGATTAAAGG + Intergenic
1042395492 8:68287037-68287059 ATTGACAGGGAGAAGATTGAAGG - Intergenic
1042420483 8:68582542-68582564 CTTGCTTTAGGGAAGATTGAGGG + Intronic
1042892454 8:73627318-73627340 CTTGCTAAAAAGCAGATTCAGGG + Intronic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1044438549 8:92195089-92195111 CTTGCCATAGAGAAAATTTAAGG - Intergenic
1047791009 8:128203608-128203630 CTGCCCAAAGAGATGATTAAAGG - Intergenic
1047934873 8:129766870-129766892 CATGTCACAGAGAACATTGAGGG + Intronic
1048683476 8:136873825-136873847 CTTGCAAAAAAGAAGATGAAAGG + Intergenic
1050249259 9:3727031-3727053 CTTGCCATATAGAAGAGTGGTGG - Intergenic
1050877635 9:10659532-10659554 CCTGTCAAAAAGAAGATGGATGG - Intergenic
1051171746 9:14324353-14324375 CTTGACCAACAGAAGAATGATGG + Intronic
1052789847 9:32865103-32865125 CTGCCCAAAGGGAAGCTTGATGG - Intergenic
1053728631 9:41029519-41029541 TTTTCCAAAGACAAGATTGCAGG + Intergenic
1054699875 9:68402561-68402583 TTTTCCAAAGACAAGATTGCAGG - Intronic
1055034884 9:71808065-71808087 CTTGCCACAAAGAACAATGAAGG + Intronic
1056137807 9:83646809-83646831 CTTGGCAAAGAGAAAAATCAAGG - Intergenic
1058804485 9:108577788-108577810 CTTGCCCAACAGAAGTCTGACGG + Intergenic
1060307940 9:122433306-122433328 CTTGGGAAAGAGAAGGTTGGTGG - Intergenic
1060486473 9:124050731-124050753 CTTGCCTGAGAGAAGCTTGGGGG - Intergenic
1061834689 9:133321101-133321123 CTTGGAAAAGAGAAGATTCCAGG - Intergenic
1187118448 X:16379060-16379082 CTTACCAAGGAGAATGTTGATGG - Intergenic
1187180244 X:16937082-16937104 CTTTCCTTAGAGAAGAGTGAGGG + Intergenic
1187423197 X:19154602-19154624 TTTGACAAAGAGAATATTTATGG + Intergenic
1187465117 X:19520041-19520063 CCTGCAAAAGAGAAGACTTAAGG - Intergenic
1187546423 X:20257202-20257224 CTTTCCCAAGTGAAGATGGAAGG - Intronic
1187754366 X:22504665-22504687 CTTCCCAAAGAGAAAATTCCAGG - Intergenic
1188474223 X:30573363-30573385 CTTGCCAAATAAAAGAAGGAAGG + Intronic
1189381987 X:40508550-40508572 CCTGCCAAAAAGAAGGCTGAGGG - Intergenic
1189614237 X:42767692-42767714 TTTGGCAAACAGAACATTGATGG - Intergenic
1190824393 X:54003731-54003753 CTTACCACAGAGGCGATTGAGGG - Intronic
1192001633 X:67158036-67158058 CTTGCCAGAGGGACGATTGTTGG - Intergenic
1192432951 X:71125057-71125079 CCACCCAAGGAGAAGATTGAAGG + Exonic
1194436321 X:93872451-93872473 CTTCCCTATGAGAAGACTGAGGG + Intergenic
1194607778 X:96003196-96003218 CTTGCTAAAACGAAGATTGGCGG + Intergenic
1195084607 X:101402374-101402396 ATAGCCAATGAGCAGATTGAGGG - Intronic
1195511848 X:105724729-105724751 CTTGGCAGAGAGCAGATTGTTGG - Intronic
1196097263 X:111813873-111813895 CATGCCAAAGAGAAGCGAGAGGG + Intronic
1196208394 X:112967407-112967429 CTTGCCTTAGGGAAGAATGAGGG + Intergenic
1196480106 X:116138382-116138404 CTTTACAAAGAGAATACTGAAGG - Intergenic
1196593468 X:117516160-117516182 CAAGTCAAAGAGAAGGTTGATGG - Intergenic
1197996463 X:132380807-132380829 CCAGGCAAAGAGGAGATTGAGGG + Intronic