ID: 1095202519

View in Genome Browser
Species Human (GRCh38)
Location 12:39400730-39400752
Sequence CTAGGTCCAGAAATAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095202517_1095202519 10 Left 1095202517 12:39400697-39400719 CCAGTAATGTGCTGATAGAGTCA 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1095202519 12:39400730-39400752 CTAGGTCCAGAAATAGAGAAAGG 0: 1
1: 0
2: 0
3: 20
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095202519 Original CRISPR CTAGGTCCAGAAATAGAGAA AGG Intronic
901256235 1:7829700-7829722 CAAGGTCCAAAAATAGTAAATGG - Intronic
901907703 1:12428596-12428618 CTCTGGCCAGAAACAGAGAAGGG - Intronic
904098797 1:28004335-28004357 CTATGCCCAGAAATATGGAAAGG - Exonic
904651495 1:32009265-32009287 CTAGCTCCAGGAAGAGAGACAGG - Intergenic
905052100 1:35060670-35060692 CTAAGTCCAGAAATCTACAAAGG + Intronic
905292709 1:36933791-36933813 CCAGCTGAAGAAATAGAGAAGGG - Intronic
905353212 1:37361907-37361929 TTAGGTCCTGAAACAGAAAAAGG - Intergenic
907386930 1:54132026-54132048 CAAACTCCAGGAATAGAGAAAGG - Intergenic
909290813 1:73880952-73880974 CCAGGTGCAGAAAGAGATAAAGG + Intergenic
909418867 1:75439737-75439759 CAAAGTCCAGAAAGAGAAAATGG + Intronic
910444064 1:87282787-87282809 CTGGGACCAGAAATAGATCATGG - Intergenic
911200735 1:95040968-95040990 TTAGGTCTAGAGATAGAGGAAGG + Intronic
911660153 1:100492329-100492351 GTGGGTCCAGAGATACAGAAAGG - Intronic
911756060 1:101558018-101558040 CATGGTTCAGAAATAGAGATGGG - Intergenic
913086669 1:115444475-115444497 CTAATTCCAGGAATAGAGCAGGG + Intergenic
913189784 1:116403867-116403889 GTAGGTCTGGAAATAGAGTAAGG - Exonic
916268352 1:162915146-162915168 TGGGGTGCAGAAATAGAGAAAGG + Intergenic
918579417 1:186108569-186108591 CTTGGCTCAGAAATGGAGAACGG + Exonic
920247569 1:204599976-204599998 CTAAGTCCCAAAATAGGGAAGGG + Intergenic
920503074 1:206497597-206497619 GTAGGGCCAGAAATGGGGAAGGG + Exonic
921783204 1:219193765-219193787 CTAAGTCCAGAAACAGAAAAAGG - Intronic
1068755297 10:60646241-60646263 CTTGGGCCAGAAATACAGTACGG + Intronic
1071344687 10:84681848-84681870 CAAAGTCCAGAGACAGAGAAGGG - Intergenic
1071518831 10:86316495-86316517 CTGGGTCCAGCACTGGAGAAAGG - Intronic
1072841635 10:98781008-98781030 CTAGGGGCAGAAAGAGATAAAGG - Intronic
1073325121 10:102639570-102639592 ATAGGTCCACCAATAGAGATGGG + Intergenic
1074380729 10:112977990-112978012 CAGGGTTTAGAAATAGAGAAAGG - Intronic
1075560503 10:123464766-123464788 CAATGGGCAGAAATAGAGAAAGG - Intergenic
1075622457 10:123937911-123937933 CTAGCACCAGAAATAGACACTGG - Intronic
1076088576 10:127658331-127658353 CAAGGTGGAGAAATAGAGTATGG + Intergenic
1076536496 10:131181211-131181233 CTGGGGCCAGAAAGAGAGAGTGG + Intronic
1076710009 10:132327892-132327914 CTGGGCCCAGAAAGAGGGAAAGG + Intronic
1077677590 11:4210128-4210150 TTTGGTCCAGGAATGGAGAATGG - Intergenic
1077986333 11:7355010-7355032 CTAGTACCTGTAATAGAGAAGGG + Intronic
1080234080 11:30048660-30048682 GAAGGTTTAGAAATAGAGAATGG - Intergenic
1081254319 11:40873482-40873504 TTAGGTCCAGTGATAGAGGAAGG - Intronic
1082108229 11:48243542-48243564 ATAGTTACAGAAACAGAGAAAGG - Intergenic
1082697609 11:56388784-56388806 TTCTGTACAGAAATAGAGAAAGG + Intergenic
1083053322 11:59796089-59796111 CAAGGTAGAGAAAAAGAGAAGGG - Intronic
1084657962 11:70530053-70530075 CTGGGTACAGAAGAAGAGAAAGG + Intronic
1087241027 11:95779894-95779916 CTAAGTCCAGAAGAAGAGCAGGG - Exonic
1088094466 11:106082193-106082215 CTATGTCCAGTAACACAGAAAGG + Intronic
1088371383 11:109091946-109091968 CAAGGCTCAGAAATGGAGAATGG - Intergenic
1091776090 12:3185792-3185814 CTAGGCCCAGAGCTGGAGAATGG + Intronic
1091865157 12:3827747-3827769 CAAGGCCCAGAAACAGTGAAGGG - Intronic
1092029455 12:5272122-5272144 CTAGATGCAGAAAGACAGAAGGG + Intergenic
1093129760 12:15376042-15376064 TGAGCTCCAGAAATAGAAAATGG + Intronic
1093184047 12:15999517-15999539 TTAGGTGCAGATACAGAGAAAGG + Intronic
1094262460 12:28516732-28516754 AGAGGGCAAGAAATAGAGAAGGG + Intronic
1095202519 12:39400730-39400752 CTAGGTCCAGAAATAGAGAAAGG + Intronic
1096950921 12:55470193-55470215 CTAGGTCCAGGAAAAGATACAGG + Intergenic
1098084016 12:66821952-66821974 CTTGGACCAGAAATAGAATAGGG + Intergenic
1098204826 12:68097437-68097459 CTAGGTCCAAAAATATTAAATGG + Intergenic
1098532299 12:71554632-71554654 CTATGCCCAGGAATAGACAAGGG + Intronic
1099423275 12:82491149-82491171 CTAGGTCCAAAATTAGTAAAAGG + Intergenic
1099637263 12:85229628-85229650 CTAGTTCCAGAAATATGAAATGG + Exonic
1100573164 12:95861912-95861934 CAAGTTCCAGAAATGGACAACGG - Intronic
1100674621 12:96853417-96853439 CCAGGTCAAGAAATAGAACATGG - Intronic
1104244093 12:127020616-127020638 CAAGGTCATGAAATACAGAAAGG - Intergenic
1108152309 13:47548927-47548949 CTAGGACGAGATAGAGAGAAAGG - Intergenic
1109020839 13:57090431-57090453 CTGAGTCCATAGATAGAGAAGGG - Intergenic
1109577138 13:64274370-64274392 CTATTTCTAGAAATTGAGAAAGG + Intergenic
1110032891 13:70639306-70639328 GTAGGTCAATAAATAGAGAGTGG + Intergenic
1111410750 13:87873582-87873604 CTAGGTACAGAAACTGGGAAAGG - Intergenic
1113578646 13:111412533-111412555 CTTGGTCCAGAACTCAAGAATGG + Intergenic
1115014609 14:28594899-28594921 CTAGATCCCGGAAGAGAGAAGGG - Intergenic
1115886230 14:37974864-37974886 GTAGGTTCCTAAATAGAGAATGG + Intronic
1120188659 14:81420141-81420163 CTGGGTCCTGAAGTAGTGAAAGG + Intronic
1120679470 14:87463058-87463080 GTGGGTTCAGAAAGAGAGAAGGG + Intergenic
1123663590 15:22587799-22587821 CTAGGTTTAAAAATAGGGAAGGG + Intergenic
1124317421 15:28682251-28682273 CTAGGTTTAAAAATAGGGAAGGG + Intergenic
1124566022 15:30815252-30815274 CTAGGTTTAAAAATAGGGAAGGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125661356 15:41397496-41397518 CGAGGTCAAGAGATAGAGACTGG + Intronic
1128494947 15:68192326-68192348 CTAGGACCAGAACAAGTGAAGGG - Exonic
1130080551 15:80729173-80729195 CAGGAACCAGAAATAGAGAAAGG - Intronic
1131772792 15:95758649-95758671 CCATGTCCAGAAATAGAACATGG - Intergenic
1134246027 16:12540865-12540887 CTGGGTCCAGAAGTGGAAAAGGG - Intronic
1134370495 16:13619741-13619763 CTATGCCCAGGAATAAAGAAGGG - Intergenic
1137514211 16:49128789-49128811 CATGGTCCAGAAAGAGAAAAGGG + Intergenic
1138344735 16:56312956-56312978 CTAGGTCAACAAAGAGAGCAAGG + Intronic
1140086762 16:71803954-71803976 TGAGGTCAAGAAATAGAAAAGGG - Intronic
1140581487 16:76235643-76235665 CCAGGTACGGAAAGAGAGAACGG + Intergenic
1140846486 16:78893481-78893503 CAAGTGCCTGAAATAGAGAAGGG + Intronic
1147237310 17:39067500-39067522 CTAGGTGCAGGAATAGGTAAAGG + Exonic
1148542517 17:48492158-48492180 CCAGGAACAGAAATAGAGAAAGG + Intergenic
1149068900 17:52516531-52516553 CAAAGTCCAAAAATAGCGAAAGG + Intergenic
1149534594 17:57422925-57422947 CTTTGTCCAGAAATAGACACTGG + Intronic
1152443932 17:80329320-80329342 CTAGGTCTAGAATTACAGACCGG + Intronic
1156318395 18:35993857-35993879 CTAAGTCCTGAGATAGAGCAGGG + Intronic
1156840383 18:41604002-41604024 CTAGGCCCTGAAAGAGAGTAAGG + Intergenic
1159530454 18:69649205-69649227 CTAGTTACAGAAAAAGAGGAAGG + Intronic
1160867597 19:1262665-1262687 ATCGGGACAGAAATAGAGAAAGG - Intronic
1162320169 19:9966874-9966896 CAAGGGGCAGAGATAGAGAAAGG + Intronic
1167289977 19:48619163-48619185 CCAGGTCCGGAAAGAGAGAACGG + Exonic
1167827227 19:51985076-51985098 CCAGGTCAAGAAATAGAATATGG - Intronic
928098359 2:28419703-28419725 CTAGGTCCAGCAAAAGGGGATGG - Intergenic
931751477 2:65334253-65334275 CTTGGCTCAGAAGTAGAGAATGG - Intronic
933149898 2:78901861-78901883 CCAGGTCAAGAAATAGACACTGG - Intergenic
935124152 2:100208208-100208230 CTGCTTCCAGAATTAGAGAAAGG + Intergenic
936999335 2:118450409-118450431 CCAGGTCTAGAAAAAGATAAAGG - Intergenic
937308230 2:120885220-120885242 CCAGGCCCAGCAACAGAGAAAGG - Intronic
939755411 2:146103328-146103350 CTATGTCCAGAAATGAACAAGGG + Intergenic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
940107988 2:150119529-150119551 CTAAGTCCAGAAATAATTAAGGG - Intergenic
940173210 2:150850635-150850657 CTAGTTATAGGAATAGAGAATGG - Intergenic
941798855 2:169632768-169632790 CTATGTCCAAAAGTAGAAAAAGG + Intronic
942291730 2:174479322-174479344 CTAGTTCCAGAAAAAATGAAAGG - Intronic
943452035 2:188055228-188055250 GAAGGTCCAGAGATAGATAAAGG + Intergenic
943547785 2:189302622-189302644 CAAGGTCCAAAAATAATGAAAGG + Intergenic
944829259 2:203516355-203516377 CAAGGTCAAGAAATAGCAAATGG + Intronic
945531661 2:210961509-210961531 GTAAGTAAAGAAATAGAGAAAGG - Intergenic
945708617 2:213267187-213267209 CTATGTACAGGAATAGATAAAGG + Intergenic
946638575 2:221757824-221757846 GTAAGTCTAGAAACAGAGAAGGG - Intergenic
947332395 2:229043979-229044001 CAAGGTCCTGAAATATGGAAGGG - Intronic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1171120047 20:22560345-22560367 CTATGTCAAGAATTAGAGAAAGG + Intergenic
1172310487 20:33914266-33914288 CTATGTCCAGATATGGGGAACGG - Intergenic
1174843358 20:53920341-53920363 CAGGGTACAGAAATAGAGAAAGG + Intergenic
1176031796 20:63016386-63016408 CTGGGTGCAGGACTAGAGAAGGG - Intergenic
1176915261 21:14618049-14618071 CTAAGACCACAAATAGAGATTGG + Intronic
1178688792 21:34733424-34733446 CTGGGACCAGATATAGAAAACGG - Intergenic
1182527014 22:30926865-30926887 CTATGTCCTGGAATAGAGCAGGG + Exonic
1184089628 22:42285381-42285403 CTAGCTCCAGGATTAGGGAAGGG - Intronic
1184529875 22:45048619-45048641 CTAGGTCCTGGAACAGAAAAAGG - Intergenic
951404351 3:22276804-22276826 CTAGGGTAAGAAATATAGAATGG + Intronic
956090838 3:65665275-65665297 ATATGTCCAGAAAAAGAAAACGG + Intronic
956972081 3:74537904-74537926 CAAGACCCAGAAACAGAGAAGGG + Intergenic
958659181 3:97043334-97043356 AAAGTTCCAGAAAGAGAGAATGG - Intronic
959477462 3:106828418-106828440 TTAGGTCCAGAGACAGGGAAAGG - Intergenic
960617278 3:119607493-119607515 ATAGGGCTAGAAACAGAGAAAGG + Intronic
962118594 3:132538160-132538182 CCAGGTCCTGCAAGAGAGAAAGG - Exonic
965550171 3:169956435-169956457 TTAGACCCAGAAATAGAGCATGG - Intergenic
966031902 3:175359840-175359862 CTAGGACCAGAAATGAAGAAAGG + Intronic
970700871 4:18736808-18736830 CTAGGTCCAAAAACAGAAAAAGG + Intergenic
971478624 4:27094913-27094935 CTAGGCCCAGAAACAGAGCTTGG + Intergenic
972221771 4:36964187-36964209 CCAGCTCCAGAAATAGAAAGGGG - Intergenic
972561632 4:40233982-40234004 GTAGGGCCATAAATTGAGAATGG - Intronic
974724557 4:65782124-65782146 CTATGCCTAGAAATAGATAAGGG - Intergenic
977662293 4:99603792-99603814 TTAGGGTCAGAAATAGAGAGTGG + Intronic
979896795 4:126168312-126168334 ATAGCTCCAGAAAAAAAGAAAGG + Intergenic
980543141 4:134220458-134220480 CATAGTTCAGAAATAGAGAAAGG - Intergenic
982009288 4:151091413-151091435 CAAGGGTCAGAAGTAGAGAAAGG - Intergenic
982303067 4:153899837-153899859 CTAGGGCCAGGAAATGAGAATGG + Intergenic
982521041 4:156416914-156416936 ACAGGTCCAGAAGTCGAGAAGGG - Intergenic
984276971 4:177622697-177622719 CCAGGTCAAGAAATAGAACATGG + Intergenic
984716213 4:182927860-182927882 CTATGTCTAGAAATGGAGGATGG - Intergenic
985855190 5:2418767-2418789 CCAGGACCAGAGATAGTGAATGG - Intergenic
987664019 5:20912758-20912780 CTAGGTCAAGAATTGGAGAGAGG - Intergenic
987690061 5:21254504-21254526 TTAGGTCCAGCAATAGAAAGTGG - Intergenic
987828880 5:23070129-23070151 CAAGTTCAAGAGATAGAGAATGG - Intergenic
988758670 5:34289433-34289455 CTAGGTCAAGAATTGGAGAGAGG + Intergenic
989220450 5:38955372-38955394 CTAGGCCTAGAAATACAGACTGG + Intronic
989737141 5:44721433-44721455 CTAGGTCTAGAAATTGAGCAAGG + Intergenic
989812367 5:45694977-45694999 CTAGTTCCTGAAACAGAGAGAGG - Intronic
993831666 5:92767669-92767691 CTAGGTCCTGAAAGAAAGTACGG + Intergenic
994140139 5:96332996-96333018 CCAGGTCCTTAAAGAGAGAAAGG - Intergenic
995174770 5:109163005-109163027 CTAGGGCCAGAGATAGGAAAAGG - Intronic
995457438 5:112367118-112367140 CTTGCTCCAGAACTAGAGAGAGG + Intronic
995948122 5:117675257-117675279 ATAGGGCCAGAATTAGAGATTGG - Intergenic
997967668 5:138372315-138372337 CTAGGTTCAGGAATACAGAAAGG - Intronic
998924394 5:147105925-147105947 ACAGGTCCAAAAATAGAGAAGGG + Intergenic
999376703 5:151091706-151091728 CTAGTTGCAGAGAGAGAGAAAGG - Intronic
999902801 5:156104506-156104528 CTAAATCCAGAATAAGAGAAGGG - Intronic
1000368947 5:160516748-160516770 CTAGGGCCAGGCATGGAGAATGG + Intergenic
1000763220 5:165252444-165252466 CTAGGTAGAGGAAAAGAGAAAGG + Intergenic
1000881915 5:166707839-166707861 CTAGGTTCAGTAATAGATAATGG + Intergenic
1001174898 5:169459022-169459044 CTGGGTCAAGGAAAAGAGAAAGG + Intergenic
1001423781 5:171609568-171609590 CTATGTCTACAAATAGAGAAAGG + Intergenic
1001598181 5:172911704-172911726 CTATGTTCAGAAACACAGAAAGG - Intronic
1002092599 5:176813834-176813856 CTAGGCCCAGCACTAGAGCAGGG - Intronic
1003480882 6:6532012-6532034 ATAGGCACAGAAATGGAGAATGG - Intergenic
1005666217 6:28059186-28059208 CTAGGTACAGAAACAAAGAATGG + Intergenic
1005694009 6:28335048-28335070 CGAGGTCCAGAGGTAGAGAAGGG - Intronic
1009525874 6:64745699-64745721 CTATGTCCAAAAATCCAGAAGGG + Intronic
1010427812 6:75746514-75746536 AAAGGACAAGAAATAGAGAAAGG + Intergenic
1010826017 6:80476331-80476353 CTAGGTGCAGGAATATAGATGGG + Intergenic
1012563745 6:100619658-100619680 CTAGTTGCAGAAATACAGAGTGG + Intronic
1014091787 6:117412084-117412106 CTATGTCAAGAAAGAGGGAAAGG + Intronic
1014361547 6:120482597-120482619 CTAGGTTCAGAAAATGAGAATGG - Intergenic
1015407974 6:132858463-132858485 GGAGGACAAGAAATAGAGAAAGG + Intergenic
1015445812 6:133303560-133303582 CTAACCCCAGAAATAGAGGAAGG - Intronic
1015806432 6:137114269-137114291 CTATGTCTAGAAATAAAGTAGGG - Intergenic
1016740164 6:147518571-147518593 CTGGTCCCAGAAATAAAGAAGGG + Intronic
1019091817 6:169542473-169542495 CAAGGTCAAGAAAGACAGAAAGG + Intronic
1020583613 7:10035887-10035909 GTAGGTCTAGAAAAACAGAATGG - Intergenic
1022644518 7:32217968-32217990 GTAGGTCCAGACATAGAAGATGG + Intronic
1024411944 7:49053880-49053902 CCAGCTCCAGGAATAGAGGATGG + Intergenic
1026735512 7:72946264-72946286 CAAGGTCCAGATTTAGGGAAGGG - Intronic
1026785852 7:73301194-73301216 CAAGGTCCAGATTTAGGGAAGGG - Intergenic
1027108212 7:75418744-75418766 CAAGGTCCAGATTTAGGGAAGGG + Exonic
1027421716 7:78023399-78023421 CCAGGTCCAAAAAAGGAGAAAGG - Intronic
1029034920 7:97509354-97509376 CTAGATCCAGCCATGGAGAAGGG - Intergenic
1029231795 7:99075993-99076015 CCAGGTCAGGAAATAGAGCATGG + Intronic
1031751995 7:125586563-125586585 CTAGGTCCATTAGTGGAGAATGG + Intergenic
1033007334 7:137580969-137580991 CTAGGTACAGATATAGATACAGG + Intronic
1033285675 7:140038847-140038869 CTGAGTCCAGCAATGGAGAAGGG + Intronic
1033880351 7:145874219-145874241 CTACGTCCAGAAATATTCAATGG + Intergenic
1034255820 7:149724145-149724167 CGAGATCAAGAAATAGAGGATGG + Intronic
1037265059 8:17049381-17049403 CTAGGTCCAGAAATAGTGTTTGG - Intronic
1038447451 8:27613909-27613931 CTAGGTCCAGAAATTCTGGAAGG + Intronic
1039249782 8:35650193-35650215 ATAGCTCCAGGAATATAGAATGG + Intronic
1040482604 8:47840390-47840412 CTGGATCCTGAAATAGAAAAAGG + Intronic
1043220812 8:77661530-77661552 CTACGACCAGAAATGAAGAAGGG - Intergenic
1043859271 8:85297336-85297358 CTAGGGTGAGAAACAGAGAAAGG + Intergenic
1045071425 8:98508451-98508473 CTAGGACTAGAAAAAGAAAAGGG + Intronic
1045647683 8:104315527-104315549 GTAGGTTCAGAAACGGAGAATGG + Intergenic
1046545933 8:115649973-115649995 CTAAATGCAGAAATAGAGGAAGG - Intronic
1047675935 8:127201679-127201701 CTATGTTCAGAACTAGAAAATGG + Intergenic
1048114278 8:131504232-131504254 CTACCTCCAGAAACAGAAAAAGG - Intergenic
1048335455 8:133498953-133498975 CTGGGTCCAAAAATTCAGAAGGG - Intronic
1050069251 9:1793112-1793134 CTAGGGCCAAAGATAAAGAAGGG - Intergenic
1050491089 9:6188552-6188574 CCAGATCCAGAAACAGAAAATGG - Intergenic
1051420224 9:16881695-16881717 ATAGGCTCAGAAACAGAGAAAGG + Intergenic
1051444517 9:17126181-17126203 CTAGAACCAGAAAAAGTGAAAGG - Intergenic
1051701223 9:19826300-19826322 ATAGGTTAAGAAATAGAGACAGG + Intergenic
1052581521 9:30361575-30361597 GTAGGTCTAGAAAAAGAGAATGG - Intergenic
1052805205 9:33007071-33007093 CTGAGTCCAGAAAGACAGAAAGG + Intronic
1052865459 9:33462305-33462327 CTTCTTCCAGAAACAGAGAAGGG - Exonic
1055188172 9:73482050-73482072 CTAAGACGAGAAATAGAGACTGG - Intergenic
1056185438 9:84129907-84129929 CTAAGTCCTGAAATAGAGGGAGG + Intergenic
1056508722 9:87282594-87282616 CTAAGTCCAGAAAGAAAAAAAGG - Intergenic
1057238375 9:93385984-93386006 CTAAGTCCAAAAATAAAGCAAGG + Intergenic
1057884043 9:98815570-98815592 CCAGGACAAGAAAAAGAGAAAGG + Intronic
1058699873 9:107591131-107591153 CTGGGTACAGAACTAGAAAATGG - Intergenic
1058792778 9:108467982-108468004 CTAAAGGCAGAAATAGAGAAGGG - Intergenic
1058894592 9:109388353-109388375 CCAGGGCCAGAGATAGTGAAGGG + Intronic
1059956085 9:119517233-119517255 CGATTTCCAGAAAAAGAGAAAGG - Intronic
1060206531 9:121685753-121685775 CTACCTGCAGAAATACAGAAGGG + Intronic
1060442816 9:123657219-123657241 CTAAATCCAGACAAAGAGAAAGG + Intronic
1061102502 9:128502996-128503018 CTAGGTCTAGAATTAGATAATGG - Intergenic
1186366859 X:8904580-8904602 CTTTTTCCAGAAACAGAGAAGGG - Intergenic
1188529104 X:31118269-31118291 CTAGGGCAAGAAACAGAGCAGGG + Intronic
1188878104 X:35457389-35457411 CTAGGTCAAAATATAGAGACAGG + Intergenic
1189291590 X:39889681-39889703 TTTGGACCTGAAATAGAGAAAGG + Intergenic
1190498093 X:51046567-51046589 TTAGGTCTAGAAATTGTGAAAGG - Intergenic
1190742455 X:53298688-53298710 GGAGTTCCAGAAATAGAGAATGG - Intronic
1191769017 X:64734798-64734820 CTAGGGCAAGAAATAGAATATGG - Intergenic
1192478642 X:71466036-71466058 CTAGTTCAAGTAAGAGAGAATGG + Intronic
1196216475 X:113058145-113058167 CTGGGTCCAGAAATGGGAAAAGG - Intergenic
1196601850 X:117610586-117610608 CTAGGGTTAGGAATAGAGAAAGG + Intergenic
1196745136 X:119064978-119065000 CTTGGCCCAGAAATAGAGCAGGG - Intergenic
1196996645 X:121390709-121390731 CTGGGTCCAGAGATGAAGAATGG + Intergenic
1198333180 X:135641206-135641228 CAATGTCCACAAAGAGAGAATGG - Intergenic
1202277582 Y:23140363-23140385 CTATATCCTGAAATATAGAAGGG + Intronic
1202277738 Y:23142744-23142766 CTACATCCAGAAATGAAGAATGG + Intronic
1202287465 Y:23266023-23266045 CTACATCCAGAAATGAAGAATGG - Intronic
1202287630 Y:23268407-23268429 CTACATCCAGAAATGAAGAATGG - Intronic
1202287795 Y:23270792-23270814 CTACATCCAGAAATGAAGAATGG - Intronic
1202287959 Y:23273176-23273198 CTACATCCAGAAATGAAGAATGG - Intronic
1202288125 Y:23275560-23275582 CTACATCCAGAAATGAAGAATGG - Intronic
1202288289 Y:23277944-23277966 CTACATCCAGAAATGAAGAATGG - Intronic
1202288446 Y:23280325-23280347 CTATATCCTGAAATATAGAAGGG - Intronic
1202430573 Y:24774087-24774109 CTATATCCTGAAATATAGAAGGG + Intronic
1202439405 Y:24884080-24884102 CTACATCCAGAAATGAAGAATGG - Intronic
1202439569 Y:24886465-24886487 CTACATCCAGAAATGAAGAATGG - Intronic
1202439734 Y:24888850-24888872 CTACATCCAGAAATGAAGAATGG - Intronic
1202439899 Y:24891234-24891256 CTACATCCAGAAATGAAGAATGG - Intronic
1202440064 Y:24893619-24893641 CTACATCCAGAAATGAAGAATGG - Intronic
1202440219 Y:24896000-24896022 CTATATCCTGAAATATAGAAGGG - Intronic