ID: 1095202969

View in Genome Browser
Species Human (GRCh38)
Location 12:39407111-39407133
Sequence TCGACAATGCAGGAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095202969 Original CRISPR TCGACAATGCAGGAGCTGGA AGG (reversed) Intronic
901437941 1:9261040-9261062 TGGGCAGTACAGGAGCTGGAGGG - Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906263100 1:44407716-44407738 TCCGCAGTCCAGGAGCTGGAAGG + Intronic
906294210 1:44639260-44639282 TCCAGGATCCAGGAGCTGGATGG - Intronic
909631510 1:77773881-77773903 TGGACAACGGAGGGGCTGGAGGG + Intergenic
910667562 1:89741506-89741528 CAGACAATGCAGTACCTGGAGGG + Intronic
913537759 1:119790593-119790615 AAGATAATGCTGGAGCTGGAAGG + Intergenic
916685275 1:167138909-167138931 GAGACAATGCAGGTGCTGTAAGG - Intergenic
919225952 1:194701860-194701882 TAGAAAATGCATGAGCTGGCAGG - Intergenic
922719640 1:227893656-227893678 AGGAGAATGCAGGAGCTGGGAGG + Intergenic
922785862 1:228281962-228281984 AAGACAATGGAGGTGCTGGAAGG + Exonic
922884556 1:229007925-229007947 GCGTCAATGCTGGAGCTGAAAGG + Intergenic
922992081 1:229922947-229922969 TCGTCACTTCAGTAGCTGGAAGG - Intergenic
924078672 1:240369143-240369165 TAGAAAAGGCAGGAGGTGGAGGG - Intronic
1062944133 10:1447504-1447526 TCAAAAATGCAGAAGCTGTATGG - Intronic
1065867199 10:29924574-29924596 TCGACAGAGCAGGGGCAGGAAGG + Intergenic
1066569237 10:36753639-36753661 TAGAAAATGCATGAGCTGGCTGG + Intergenic
1067557423 10:47282618-47282640 TTGACACAGCAGGAGGTGGAAGG + Intergenic
1068855565 10:61794326-61794348 TTGTCATTGCAGGGGCTGGAGGG - Intergenic
1069789519 10:71010764-71010786 TCAACACTGAAGGAGCTGGGAGG - Intergenic
1069876008 10:71563277-71563299 GCTGGAATGCAGGAGCTGGAAGG - Intronic
1072736166 10:97881107-97881129 TCTGCAATTCAGCAGCTGGAGGG + Intronic
1074252848 10:111770059-111770081 TCAACAATCTCGGAGCTGGAAGG - Intergenic
1074872248 10:117586536-117586558 TGGACAATGCAGGACCTAGGGGG + Intergenic
1075873145 10:125785825-125785847 TCCTCCATCCAGGAGCTGGAGGG + Intronic
1091460573 12:641317-641339 TCTGCAAAGCAGGAGGTGGAGGG - Intronic
1092926118 12:13274132-13274154 GCGACAGAGCCGGAGCTGGAGGG - Intergenic
1095202969 12:39407111-39407133 TCGACAATGCAGGAGCTGGAAGG - Intronic
1095875030 12:47070880-47070902 CTGAAAATGCAGGAGATGGAAGG - Intergenic
1097959952 12:65522542-65522564 TCGACTGGGCAGAAGCTGGAAGG + Intergenic
1104044710 12:125153619-125153641 TCGCCATAGCAGGAGATGGAGGG - Intergenic
1106376439 13:29193157-29193179 TACACAGTGCAGGAGCTGGTGGG + Intronic
1106763181 13:32887801-32887823 TCCACAGAGCAGGAGCTGGCTGG + Intergenic
1107514587 13:41116625-41116647 TGGCCAAAGCAGGAGCTAGAGGG + Intergenic
1113030005 13:105982717-105982739 TCCACAGTGCAGGAGCTGTGGGG + Intergenic
1113513392 13:110872951-110872973 TCGACAACACAGCAGCTGTAGGG + Intergenic
1115513079 14:34157665-34157687 CTGACAATGCAGGAGGTGCATGG - Intronic
1119724614 14:76914445-76914467 TAGACACTGCAGGACCTGGCTGG + Intergenic
1121159798 14:91726866-91726888 TCTACAACGCTGGAGCAGGAAGG + Intronic
1122513564 14:102289805-102289827 TTGACAAAGAAGGAGCTTGAGGG - Intronic
1127686271 15:61348554-61348576 TGGACATGGCAGAAGCTGGAAGG - Intergenic
1133146806 16:3793444-3793466 TCGACAATGCGGGAGCGAGCAGG + Exonic
1133200789 16:4203307-4203329 TCCACAATGGAGGAGCTGCCTGG - Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1133770769 16:8866350-8866372 TTAACAGTGCAGGAGGTGGAAGG + Intronic
1134830005 16:17315278-17315300 TCCACAAGGCAGGAGATAGATGG - Intronic
1136632526 16:31497228-31497250 TAGCCCAAGCAGGAGCTGGAGGG - Intronic
1137071097 16:35905494-35905516 AGGAAAATGCAGCAGCTGGAGGG + Intergenic
1140860923 16:79017108-79017130 TGGACAAGGCAAGAGATGGATGG - Intronic
1142103471 16:88288632-88288654 TCTAGAATGCTGGAGCTAGACGG + Intergenic
1142276391 16:89121036-89121058 TGGACACTGCAGGTGCTGGCTGG + Intronic
1144742185 17:17590161-17590183 GTGAAAATGCAGGAGCTGTAGGG + Intronic
1145202284 17:20957072-20957094 GTGACAAGGCAGGAACTGGATGG - Intergenic
1151763589 17:76121363-76121385 TCGACAGGGGAGGAGCTGGGAGG + Intronic
1157710513 18:49846944-49846966 TGGACACAGCAGGAGCTGGGGGG + Intronic
1162159840 19:8703630-8703652 TAGACAAAACAGTAGCTGGAAGG - Intergenic
1163509844 19:17727893-17727915 TCCACCATGCAGATGCTGGATGG - Exonic
1164278714 19:23749012-23749034 TCTGCAATGCAGGAGCTAGAAGG + Intronic
1164547569 19:29181750-29181772 ACGACAGTGCAGGAGCAGGTAGG + Intergenic
1164569617 19:29363395-29363417 GCAACATTGCAGGACCTGGAGGG + Intergenic
1167019172 19:46861306-46861328 CGAACAATGGAGGAGCTGGAGGG + Intergenic
925556478 2:5136348-5136370 TCTACAATCCAGGGGGTGGAGGG + Intergenic
925930110 2:8700192-8700214 TAGACATTTCAGCAGCTGGAGGG - Intergenic
925982003 2:9184591-9184613 TGGACATTGCATGAGCCGGAAGG + Intergenic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
932851405 2:75191259-75191281 TGAACAATGCAGGAGTTGGAGGG + Intronic
933795436 2:85915670-85915692 TCAAAAATGTAGGGGCTGGAAGG - Intergenic
938644766 2:133319161-133319183 TTGAAAATGCAGGGGGTGGAAGG - Intronic
942016578 2:171823326-171823348 TACAGAATGCAGGAGCTTGAAGG + Intronic
945045002 2:205774127-205774149 TCGAAAATCCAGCAGCAGGATGG + Intronic
948626472 2:239272113-239272135 TAGACACTGCAGAAGCTGGCTGG + Intronic
948656789 2:239481217-239481239 TGAACAATTCAGGAGATGGATGG - Intergenic
1168874594 20:1162521-1162543 TGGAGAATGCATGAGCTAGAAGG - Intronic
1169482595 20:5998249-5998271 CCTATAATGCAGGGGCTGGAAGG + Intergenic
1171107937 20:22453593-22453615 TCAACAATGCAGGGGGTGGGTGG - Intergenic
1173080591 20:39863329-39863351 TCCCCAATCCAGGAGCTGAAGGG + Intergenic
1185339811 22:50286250-50286272 TCGTCTAAGGAGGAGCTGGATGG + Exonic
952213600 3:31253763-31253785 TGGAAAATGAAGGAGTTGGACGG - Intergenic
953120817 3:40039844-40039866 TCTACAATCAAGGCGCTGGAAGG + Intronic
953439688 3:42906753-42906775 TTTGCAATGCAGGAGCAGGAAGG + Intronic
953813581 3:46134653-46134675 GCGACAGGGCAGCAGCTGGAGGG - Intergenic
954636626 3:52074392-52074414 TCGACAGTGCAGGGGGAGGATGG + Intergenic
960231153 3:115229081-115229103 TCCCCAATGCTGGAGATGGAGGG - Intergenic
961095261 3:124149391-124149413 TCCACAATGCATGATCTTGAAGG + Intronic
968056641 3:195696956-195696978 CGGACAATGCAGGAGCTGGATGG - Intergenic
970301776 4:14688873-14688895 TAGACACAGCAGGAGCTGGAAGG - Intergenic
971345496 4:25808495-25808517 TCGAGAATTCAGGAGCAGAAAGG + Intronic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
979456111 4:120927707-120927729 TCCAGAATGCAAGAGCTGTAGGG + Intergenic
979626417 4:122849963-122849985 TCAAGAATGCAGAAGCTGGCTGG + Intronic
984344549 4:178505844-178505866 TCCACAATGCAGAAACTGGAAGG + Intergenic
985014765 4:185622847-185622869 TGGAAAATGAAAGAGCTGGAGGG + Intronic
993639961 5:90390782-90390804 TTGAGAATGAAGGAGCTAGAGGG - Intergenic
993860579 5:93131911-93131933 TGGTGAATGCAGGAGCTGGAAGG - Intergenic
999251298 5:150183862-150183884 TCTAGAACACAGGAGCTGGAAGG - Exonic
1005525138 6:26640021-26640043 TTGATAATGCAGGAGAGGGAGGG - Intronic
1005681688 6:28215262-28215284 CCGACAGTGCAGGAGTTAGAGGG - Intergenic
1006790402 6:36697641-36697663 TGGAGAATGCTGGAGCTGGCAGG - Intergenic
1006942404 6:37761745-37761767 TCTACAACACAGGAGCTGGGAGG + Intergenic
1007234577 6:40381228-40381250 TCCAAAATGTAGGGGCTGGATGG - Intergenic
1009903357 6:69837334-69837356 TTGACACTGCAGGAGCCAGAAGG + Intergenic
1016895856 6:149051719-149051741 TCGCCACTGCAATAGCTGGATGG - Intronic
1017105477 6:150883890-150883912 TAGACCCTGCAGGGGCTGGATGG + Intronic
1020021753 7:4873512-4873534 GAGAGAATGCAGGAGCTGAAGGG + Intronic
1021577429 7:22117052-22117074 TGGAGAATGCAGGAGATGAAGGG - Intergenic
1023263660 7:38382499-38382521 TTGAAAATGAAGGAGATGGAGGG - Intergenic
1023923696 7:44649587-44649609 GGGACAATGCAGGTTCTGGAAGG - Intronic
1023931800 7:44710837-44710859 GCGACAATTCAGGAGCTTCAGGG - Intergenic
1024951226 7:54862749-54862771 ATGACAATGGAGGAGCTGCAAGG - Intergenic
1028621467 7:92833478-92833500 TCGCCGCTGCAGAAGCTGGATGG + Exonic
1034509575 7:151522695-151522717 TTGACTTTGCAGCAGCTGGAAGG + Intergenic
1036104327 8:5824073-5824095 TCGACCATGCATGGGCTGTATGG - Intergenic
1036612479 8:10362366-10362388 TCAACAATGCAGGAGGAGAAAGG - Intronic
1038396311 8:27248077-27248099 ACCACCAGGCAGGAGCTGGAGGG - Intronic
1047766286 8:127992650-127992672 TAGACAGGTCAGGAGCTGGAAGG - Intergenic
1048191120 8:132290280-132290302 TAGACAATGGAGGAGATGGTAGG + Intronic
1049663450 8:143831027-143831049 TCCACAATGGAGGGGGTGGATGG + Intergenic
1050365551 9:4870397-4870419 TCAAGAATGCAAGAGCTGGCTGG - Intronic
1053140487 9:35679739-35679761 TGGGGAATACAGGAGCTGGAGGG + Intronic
1055594277 9:77849627-77849649 TCCACAAAGCAAGAGCTGGCAGG + Intronic
1057906302 9:98986075-98986097 TGGGCAATGCAGGAGCTACAGGG + Exonic
1061630993 9:131872110-131872132 TCCACCAGCCAGGAGCTGGAAGG - Intronic
1062306353 9:135908893-135908915 TCGAGAACGCAGGAGCTGGAAGG + Intergenic
1186188799 X:7048750-7048772 TCACCACTGCAGGAGCAGGACGG + Intergenic
1187822016 X:23297893-23297915 TGGACAAAACAGGAGCTGGGTGG - Intergenic
1196208694 X:112970665-112970687 TAGACAATGTTGGAACTGGAAGG + Intergenic
1196539251 X:116885466-116885488 TAGAGAATACTGGAGCTGGAAGG + Intergenic
1201724612 Y:17138908-17138930 TAGACATTGGAGGAGCAGGAGGG + Intergenic