ID: 1095204162

View in Genome Browser
Species Human (GRCh38)
Location 12:39420350-39420372
Sequence CTCTCATCACAGATGTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095204161_1095204162 2 Left 1095204161 12:39420325-39420347 CCAAGAGGTCAGACAGAGAGTAG 0: 1
1: 0
2: 2
3: 25
4: 215
Right 1095204162 12:39420350-39420372 CTCTCATCACAGATGTAGCAAGG 0: 1
1: 0
2: 2
3: 10
4: 138
1095204159_1095204162 13 Left 1095204159 12:39420314-39420336 CCAGGGGATTCCCAAGAGGTCAG 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1095204162 12:39420350-39420372 CTCTCATCACAGATGTAGCAAGG 0: 1
1: 0
2: 2
3: 10
4: 138
1095204160_1095204162 3 Left 1095204160 12:39420324-39420346 CCCAAGAGGTCAGACAGAGAGTA 0: 1
1: 0
2: 2
3: 17
4: 248
Right 1095204162 12:39420350-39420372 CTCTCATCACAGATGTAGCAAGG 0: 1
1: 0
2: 2
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095204162 Original CRISPR CTCTCATCACAGATGTAGCA AGG Intronic
901137431 1:7007141-7007163 CTCTCTTCTCAGAGGTAGCATGG - Intronic
901414338 1:9106344-9106366 TTCTCAACACAGAAGCAGCAGGG + Intronic
902745457 1:18470769-18470791 CTCTCGTCACTGCTGTAACACGG - Intergenic
903117377 1:21189312-21189334 GTCTCAGCACAAAAGTAGCAGGG - Intergenic
905070927 1:35224700-35224722 CTCTCAGCAGAGAAGTAGCCTGG - Intergenic
907594002 1:55703239-55703261 CTATAATCACAAATCTAGCAAGG + Intergenic
909353646 1:74682477-74682499 TTCTCTTAACAGAGGTAGCATGG - Intergenic
909690299 1:78399284-78399306 CTCTCATCCTAGATGTTTCAAGG - Intronic
917078887 1:171236529-171236551 GTCTGATCACAGATTTACCAGGG + Intergenic
919111811 1:193229464-193229486 CTCCTATCACAGAAGGAGCAAGG - Intronic
921621403 1:217329976-217329998 CTCTCCTCTCAGATCTAGTAGGG + Intergenic
1067938180 10:50629019-50629041 TTATCTTCACAGTTGTAGCAAGG + Intergenic
1070388828 10:75951122-75951144 CTCTCATCATAGCTGAACCAGGG - Intronic
1072085493 10:92075182-92075204 CTCTAATCACAGTAATAGCAGGG + Intronic
1072246353 10:93547431-93547453 GTCTGGTCACAGATGTGGCAGGG + Intergenic
1072983197 10:100116983-100117005 CTCTCATCTCAAATGTATGAAGG - Intergenic
1079114947 11:17634933-17634955 CTCTCACCACAGCTGTAGCTGGG - Exonic
1083596888 11:63921934-63921956 CTCTCAACACTGTTGTAGTAGGG - Intergenic
1085667201 11:78424961-78424983 TTCTCAACACAAATGTAGGAGGG - Intergenic
1085811702 11:79688475-79688497 TTCTCATCACAGATGAGGAAGGG + Intergenic
1086229062 11:84546602-84546624 CTCTCATACCTCATGTAGCATGG + Intronic
1087660250 11:100979312-100979334 CTGTCATCAAAGATGTATAAAGG - Intronic
1087896716 11:103594496-103594518 TGCTCATCTCAGATGTAGCCAGG + Intergenic
1089668136 11:120033179-120033201 CTCTCATCACAGAGCAAGCCTGG + Intergenic
1090863773 11:130676951-130676973 CTCCCCTCACATATGAAGCAGGG + Intronic
1092243088 12:6847386-6847408 CAAACATCACAGATGTACCAGGG - Exonic
1095204162 12:39420350-39420372 CTCTCATCACAGATGTAGCAAGG + Intronic
1096753757 12:53781594-53781616 CTGACATCACAGATGGTGCAGGG + Intergenic
1099433012 12:82610489-82610511 CTCTCTTCCCTGATGTAGAATGG - Intergenic
1103044990 12:117728700-117728722 CTCTCATCTCAGGTGATGCAGGG + Intronic
1109366422 13:61362601-61362623 CTATCCTCACAAATGTAGGAGGG - Intergenic
1109815777 13:67582473-67582495 CTTTCATCAGAGATTTAGCTGGG + Intergenic
1113507393 13:110826661-110826683 CTCTCATCAGACATTGAGCACGG - Intergenic
1115344079 14:32323509-32323531 CTCCCATTTCAGATGTAGCCAGG - Intergenic
1115871520 14:37809615-37809637 CTCAGACCACACATGTAGCAGGG + Intronic
1116748911 14:48856692-48856714 CTCCTAACAAAGATGTAGCATGG + Intergenic
1117959263 14:61147118-61147140 CTCTTGTCACAGCTGTATCATGG - Intergenic
1118375157 14:65170541-65170563 CTCCCAAGACAGACGTAGCATGG + Intergenic
1118446061 14:65852173-65852195 TTCTCATGACAGAGGTAGCTTGG + Intergenic
1118625783 14:67657712-67657734 CTCCCAGAACAGAAGTAGCAAGG + Intronic
1119967846 14:78936868-78936890 CTCTCATCAAAGATGTAGGATGG + Intronic
1120534371 14:85675645-85675667 CTTTCATCCCAAAAGTAGCAAGG + Intergenic
1121918212 14:97855419-97855441 CTCTTATCCCATTTGTAGCATGG - Intergenic
1123051110 14:105543597-105543619 TTATCATCACAGTTATAGCAGGG + Intergenic
1124863218 15:33463241-33463263 CTCTAACCTCAGAGGTAGCAAGG - Intronic
1127048438 15:55052914-55052936 CTCACACCACAGAAGTAGAAGGG - Intergenic
1128873492 15:71182977-71182999 AACTCATCACACATGTATCAAGG + Intronic
1129678202 15:77643633-77643655 CCCTCATCACAGGGGTGGCATGG + Intronic
1131351427 15:91704153-91704175 TTCTAATCATAGATGTATCAGGG + Intergenic
1132020547 15:98358148-98358170 CTCACATGACAGAAGAAGCAAGG - Intergenic
1135489695 16:22898812-22898834 TTCTCATCATAGAGGGAGCAAGG - Intronic
1138310852 16:56022670-56022692 CTCTGATCCCAGATGAAGCCTGG - Intergenic
1138408458 16:56818664-56818686 CCCACATCACTGATGTAGCTTGG - Exonic
1140697684 16:77551118-77551140 CTCCGATCACAGATGAAGAAAGG + Intergenic
1141000343 16:80301836-80301858 CTCTCACCACAAATGTATGAGGG + Intergenic
1143813718 17:9493701-9493723 CTCTCAAAACAGAACTAGCAGGG - Intronic
1144444691 17:15316122-15316144 GCCTCAGCACAGAAGTAGCAAGG - Intronic
1148327487 17:46791686-46791708 CATTCATCACAGAAGTAGGAAGG + Intronic
1148380234 17:47191284-47191306 CTCTCATCTCATATCTAGCGTGG - Intergenic
1150706162 17:67489262-67489284 CTGTCCTCACAGATGTGGTATGG + Intronic
1153755521 18:8279311-8279333 CTCTCAAGCCTGATGTAGCAGGG + Intronic
1156495301 18:37521627-37521649 ATGTCATCACAGATGCACCACGG + Intronic
1158065916 18:53408207-53408229 ATATTATCACAAATGTAGCAGGG + Intronic
1158716889 18:59888593-59888615 CTCTCCTGACAGGTGTACCAGGG + Intergenic
1160426628 18:78782701-78782723 CGCTCATCACAGATGTGTCCGGG + Intergenic
1164851200 19:31485573-31485595 CTCCCATCACAGGTTTAGGAGGG - Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1168181268 19:54664318-54664340 CTCTGATCTCAGATGCAGTAGGG - Exonic
927432288 2:23036928-23036950 CTCTCAAAACAGATGTACCCTGG - Intergenic
931238204 2:60429560-60429582 CTCTCATCACAGACTTGGAAGGG + Intergenic
932403928 2:71500937-71500959 CTCTGATCTCTGATGTCGCATGG + Intronic
932973211 2:76571056-76571078 CTCTCAGCACAGATTGGGCAGGG + Intergenic
936505858 2:113105408-113105430 CACTCATTAAAGATGTATCAGGG + Intergenic
940742419 2:157524023-157524045 CTCTTTTCAGGGATGTAGCAAGG + Intergenic
943252569 2:185547389-185547411 GTCTCATCACAGATGTACCATGG + Intergenic
945507185 2:210656385-210656407 CTCTCATCAGGAATGTAGCAAGG + Intronic
945849624 2:214989775-214989797 CTTGCTTCACAGTTGTAGCATGG - Intronic
946363508 2:219234052-219234074 CTCTCAATGCAGATGTAGCTGGG - Intronic
947961122 2:234238324-234238346 CTCTCCTCCCAGAAGAAGCAAGG + Intergenic
1170495572 20:16921127-16921149 ATCACATCACAGTTGTTGCAGGG - Intergenic
1174551804 20:51367549-51367571 TTCTAATCACAGGAGTAGCATGG + Intergenic
1174707744 20:52674460-52674482 CACTCCTCACAGCTGTACCAGGG + Intergenic
1175083729 20:56442135-56442157 CTGTCAACACAGATATAGAAAGG - Intronic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177485307 21:21747926-21747948 CTCTCATCACATATGTCTCAGGG + Intergenic
1179335228 21:40445120-40445142 CTCTCATAACAGATGTTGAAGGG - Intronic
1181097773 22:20517658-20517680 CTCTCAGGACTGCTGTAGCAGGG + Intronic
1182244221 22:28942648-28942670 CTCTAACCTCAGACGTAGCACGG - Intronic
951522543 3:23622700-23622722 CTCCCATCACAGAAGGGGCAAGG + Intergenic
954105300 3:48406619-48406641 ATCTCATCACAGAGCAAGCAGGG - Intronic
955115723 3:55998841-55998863 TTCTCAACACATATTTAGCAGGG - Intronic
956663110 3:71618483-71618505 CTCTAGTCACAGATGGATCATGG - Intergenic
956791730 3:72685251-72685273 CTGACTTCACAGACGTAGCAGGG + Intergenic
958145599 3:89620583-89620605 CTGTATTCACAGGTGTAGCAAGG - Intergenic
968828361 4:2915991-2916013 CTCTCATCACAGCTGCTGGATGG - Intronic
976062222 4:81141873-81141895 CCCCCATCAGAGATGAAGCAAGG + Intronic
976207485 4:82636749-82636771 CTCTCTCCCCAGATGTACCAGGG + Exonic
979697335 4:123628183-123628205 CTCTGATCCAAGAAGTAGCAAGG + Intergenic
980918595 4:139059237-139059259 GTCTCATTACAGGTGTACCATGG + Exonic
987770784 5:22301391-22301413 CTGTCATCAAATATGTAGTATGG + Intronic
991232080 5:64345679-64345701 CTGTCATGACAGATGTAAAAAGG + Intronic
991262969 5:64686599-64686621 CTCTCACCATAGTTGTTGCATGG + Intergenic
995257168 5:110060077-110060099 CTCTAATCACAGCTGTAACAAGG + Intergenic
996053670 5:118961193-118961215 CTGTCATCACAGTTTTAGTAGGG - Intronic
1000056060 5:157607607-157607629 TTCTCATCACAGAGGTAGTCTGG - Intergenic
1003513676 6:6801823-6801845 CTCTCACCACAGGTGCAGGAAGG - Intergenic
1009539082 6:64927564-64927586 CTTTCATCACTGATTTGGCAAGG + Intronic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1011709961 6:90043248-90043270 CTCTCAACACTGCTGTCGCAAGG - Intronic
1013085714 6:106855384-106855406 CTGTCATCAAAGATGAAGCTTGG - Intergenic
1015426146 6:133070119-133070141 CTCTCAACACAGTTGAACCAGGG + Intergenic
1017667389 6:156733761-156733783 TTGTCCTCACAGATGTAGGAAGG - Intergenic
1017972507 6:159325485-159325507 CTCTCATCACAGTTGTCTAAGGG - Intergenic
1020542022 7:9470383-9470405 CTCCCATCACAGACGTAGGAGGG + Intergenic
1020976857 7:15017207-15017229 TTTGCATCACAGATGTGGCAAGG - Intergenic
1021685171 7:23178393-23178415 CTCTCATAACAGATTTAAAATGG + Intergenic
1022195920 7:28067252-28067274 CTCACAACACTGATGGAGCAAGG - Intronic
1022600343 7:31752255-31752277 CTAAAATCACAGAAGTAGCAAGG - Exonic
1024144109 7:46493884-46493906 CTCTTATAACAGAAATAGCATGG + Intergenic
1024480234 7:49855085-49855107 CTATCTTCACAGCTGTACCAAGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026534929 7:71231661-71231683 CTCACATGACAGATAGAGCAAGG + Intronic
1026940010 7:74282230-74282252 CTCTGATAAAAGATTTAGCAAGG - Intergenic
1029170847 7:98628101-98628123 CTCCCAGCGGAGATGTAGCAGGG - Intronic
1031840152 7:126728173-126728195 CTCTCTTCACAGATCCAGTAGGG + Intronic
1032571736 7:133007659-133007681 GGCTCAGCAGAGATGTAGCAGGG - Intronic
1033944922 7:146705115-146705137 CTCTCATCACGGCATTAGCAAGG - Intronic
1033986549 7:147233204-147233226 CTCTCATGACTGTTTTAGCAGGG + Intronic
1036591233 8:10170360-10170382 CTCACATCACAGAAGGCGCAAGG - Intronic
1038113479 8:24526061-24526083 GTGTCATCACAGAGGTAGCCTGG - Intronic
1040293007 8:46135069-46135091 CTCTCATCACAGAAGTCTCCAGG - Intergenic
1040333681 8:46405283-46405305 CTCTCATCACAGAAGTCCCCAGG + Intergenic
1042291278 8:67171496-67171518 CTCTCATCTCAGCAGTAGCCAGG + Intronic
1042507912 8:69580715-69580737 CTCACATCACTGAGGTAGAAGGG + Intronic
1043407454 8:79952273-79952295 CTATCATGACAGATTTAACAAGG + Intronic
1045680315 8:104652423-104652445 TTCTTATCACAGATGAAGCATGG + Intronic
1046598562 8:116290036-116290058 CTCTCATCACAGCTGTGGAGTGG + Intergenic
1047440363 8:124872233-124872255 CTGTGATCACAGGTGTGGCAAGG - Intergenic
1050485715 9:6132652-6132674 ATCTCATCACTGATGTAGTGTGG + Intergenic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1056571274 9:87817694-87817716 GTCTCATTACAGGTGTACCATGG - Intergenic
1057989507 9:99753445-99753467 TTATAATCACAGATGTAGGATGG - Intergenic
1058911967 9:109529180-109529202 CTCTCATGACACATGAAGGAGGG + Intergenic
1061647374 9:132015921-132015943 CTCTCTTCTCAGATTAAGCAAGG + Intronic
1186363406 X:8866715-8866737 CTTTCCTCACAGAGGTAGCATGG + Intergenic
1186965581 X:14783276-14783298 CTCACATCAAAGACCTAGCAGGG - Intergenic
1189329975 X:40138316-40138338 CGCTCAGCACATAAGTAGCAGGG - Intronic
1193610959 X:83631131-83631153 CTCCCACCACAGTAGTAGCAGGG + Intergenic
1194414595 X:93595216-93595238 CTCTCATTACATATCTAGCATGG - Intergenic
1197404240 X:126029952-126029974 CTCCCACCACAGCAGTAGCAGGG + Intergenic
1199902672 X:152192404-152192426 CACTCATCACAGATGTGGTTTGG - Intronic