ID: 1095214849

View in Genome Browser
Species Human (GRCh38)
Location 12:39536321-39536343
Sequence CAGTGCCACCAGAGTTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095214849_1095214850 12 Left 1095214849 12:39536321-39536343 CCACAGAAACTCTGGTGGCACTG No data
Right 1095214850 12:39536356-39536378 GTGTCTTAGATCTGCAGTAGAGG No data
1095214849_1095214851 13 Left 1095214849 12:39536321-39536343 CCACAGAAACTCTGGTGGCACTG No data
Right 1095214851 12:39536357-39536379 TGTCTTAGATCTGCAGTAGAGGG No data
1095214849_1095214852 14 Left 1095214849 12:39536321-39536343 CCACAGAAACTCTGGTGGCACTG No data
Right 1095214852 12:39536358-39536380 GTCTTAGATCTGCAGTAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095214849 Original CRISPR CAGTGCCACCAGAGTTTCTG TGG (reversed) Intergenic
No off target data available for this crispr