ID: 1095214849 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:39536321-39536343 |
| Sequence | CAGTGCCACCAGAGTTTCTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1095214849_1095214850 | 12 | Left | 1095214849 | 12:39536321-39536343 | CCACAGAAACTCTGGTGGCACTG | No data | ||
| Right | 1095214850 | 12:39536356-39536378 | GTGTCTTAGATCTGCAGTAGAGG | No data | ||||
| 1095214849_1095214851 | 13 | Left | 1095214849 | 12:39536321-39536343 | CCACAGAAACTCTGGTGGCACTG | No data | ||
| Right | 1095214851 | 12:39536357-39536379 | TGTCTTAGATCTGCAGTAGAGGG | No data | ||||
| 1095214849_1095214852 | 14 | Left | 1095214849 | 12:39536321-39536343 | CCACAGAAACTCTGGTGGCACTG | No data | ||
| Right | 1095214852 | 12:39536358-39536380 | GTCTTAGATCTGCAGTAGAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1095214849 | Original CRISPR | CAGTGCCACCAGAGTTTCTG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||