ID: 1095214850

View in Genome Browser
Species Human (GRCh38)
Location 12:39536356-39536378
Sequence GTGTCTTAGATCTGCAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095214845_1095214850 26 Left 1095214845 12:39536307-39536329 CCCAGACAATTCTACCACAGAAA No data
Right 1095214850 12:39536356-39536378 GTGTCTTAGATCTGCAGTAGAGG No data
1095214844_1095214850 27 Left 1095214844 12:39536306-39536328 CCCCAGACAATTCTACCACAGAA No data
Right 1095214850 12:39536356-39536378 GTGTCTTAGATCTGCAGTAGAGG No data
1095214846_1095214850 25 Left 1095214846 12:39536308-39536330 CCAGACAATTCTACCACAGAAAC No data
Right 1095214850 12:39536356-39536378 GTGTCTTAGATCTGCAGTAGAGG No data
1095214849_1095214850 12 Left 1095214849 12:39536321-39536343 CCACAGAAACTCTGGTGGCACTG No data
Right 1095214850 12:39536356-39536378 GTGTCTTAGATCTGCAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095214850 Original CRISPR GTGTCTTAGATCTGCAGTAG AGG Intergenic
No off target data available for this crispr