ID: 1095214851

View in Genome Browser
Species Human (GRCh38)
Location 12:39536357-39536379
Sequence TGTCTTAGATCTGCAGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095214844_1095214851 28 Left 1095214844 12:39536306-39536328 CCCCAGACAATTCTACCACAGAA No data
Right 1095214851 12:39536357-39536379 TGTCTTAGATCTGCAGTAGAGGG No data
1095214845_1095214851 27 Left 1095214845 12:39536307-39536329 CCCAGACAATTCTACCACAGAAA No data
Right 1095214851 12:39536357-39536379 TGTCTTAGATCTGCAGTAGAGGG No data
1095214849_1095214851 13 Left 1095214849 12:39536321-39536343 CCACAGAAACTCTGGTGGCACTG No data
Right 1095214851 12:39536357-39536379 TGTCTTAGATCTGCAGTAGAGGG No data
1095214846_1095214851 26 Left 1095214846 12:39536308-39536330 CCAGACAATTCTACCACAGAAAC No data
Right 1095214851 12:39536357-39536379 TGTCTTAGATCTGCAGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095214851 Original CRISPR TGTCTTAGATCTGCAGTAGA GGG Intergenic
No off target data available for this crispr