ID: 1095214987

View in Genome Browser
Species Human (GRCh38)
Location 12:39537920-39537942
Sequence CAGATGAATCAGAATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095214985_1095214987 16 Left 1095214985 12:39537881-39537903 CCTGGTTGCTATCAATAAGAAAG No data
Right 1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095214987 Original CRISPR CAGATGAATCAGAATGAGGC AGG Intergenic
No off target data available for this crispr