ID: 1095220110

View in Genome Browser
Species Human (GRCh38)
Location 12:39601521-39601543
Sequence ATGAAGAAGTTGTCTTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095220108_1095220110 -5 Left 1095220108 12:39601503-39601525 CCTATTCCACACAATAGGATGAA 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1095220110 12:39601521-39601543 ATGAAGAAGTTGTCTTATTATGG 0: 1
1: 0
2: 1
3: 29
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095220110 Original CRISPR ATGAAGAAGTTGTCTTATTA TGG Intronic
901775077 1:11555054-11555076 ATGTAGAAGTTGGGTAATTAAGG - Intergenic
904950322 1:34233033-34233055 CTCAAGGAGTTGTCTTATTTTGG + Intergenic
907581150 1:55573888-55573910 AGGAAGGAGTTCTATTATTAGGG + Intergenic
909202562 1:72709886-72709908 ATGTAGAAGTTATTTTACTAAGG + Intergenic
910051511 1:82979316-82979338 CTGAAGTAGTTGTCTATTTATGG - Intergenic
911479924 1:98425587-98425609 GTGAAGAACTTGTCTCATTTTGG - Intergenic
911765988 1:101675537-101675559 TTGAAGAAGCTGTCATAATAAGG + Intergenic
911766113 1:101677082-101677104 ATGAAGATATTGTCCTATTCTGG - Intergenic
912084901 1:105987513-105987535 ATGTAGAAGTTGTCTTGATAAGG + Intergenic
912696333 1:111844880-111844902 TTGAAGAAGATGTCTGATGAAGG - Intronic
913408959 1:118529469-118529491 CAGAAAATGTTGTCTTATTAAGG + Intergenic
915102445 1:153510073-153510095 ATGTTGAAGTTGTATTAATAGGG - Intergenic
917687874 1:177436324-177436346 ATGAAGGAGATGTCTCATGATGG + Intergenic
918615402 1:186538642-186538664 ATGAAGAATTTGTTTAATTTGGG + Intergenic
919470131 1:197968211-197968233 ATGAAGAAGTTATCTTATTGAGG + Intergenic
921455982 1:215372565-215372587 ATGAAAAAGTCTTCTTATTCTGG + Intergenic
1063282555 10:4646240-4646262 ATGAGGAAGTTTTCTTACCAAGG + Intergenic
1064313077 10:14229177-14229199 ATGAGAAAGTTGTCTTATCCTGG - Intronic
1066054229 10:31665498-31665520 AGGAAGAGGGTGTCTGATTAGGG + Intergenic
1067482741 10:46614689-46614711 ATCAAGAAGTTGTTTTATTCAGG - Intergenic
1067612013 10:47726975-47726997 ATCAAGAAGTTGTTTTATTCAGG + Intergenic
1068735737 10:60411374-60411396 ATGAAGTTGTTGTGCTATTAAGG + Intronic
1071627431 10:87187219-87187241 ATCAAGAAGTTGTTTTATTCAGG + Intronic
1072182758 10:93003556-93003578 ATAAAGAAGTTGACTTAACATGG - Intronic
1073630577 10:105144337-105144359 CTCAAGAAGTTGTCTTCTGATGG - Intronic
1074627183 10:115203181-115203203 ATGATGAATTTCTTTTATTATGG + Intronic
1075308191 10:121386982-121387004 TTGTAGAAGGTGTCTTAATATGG - Intergenic
1078505435 11:11938025-11938047 ATGAACAAGGTGGCTTAATAAGG + Intronic
1078862822 11:15267746-15267768 TTGATGGAGTTTTCTTATTATGG + Intergenic
1079022552 11:16921632-16921654 ATGAAGAAGTTGAGCTGTTAGGG - Intronic
1080190130 11:29535140-29535162 ATGAAGTAGTTGTGTTTTTGTGG + Intergenic
1080340843 11:31261841-31261863 ATGAAAAAGTTATTTTGTTATGG - Intronic
1080509995 11:32959713-32959735 CTGAAGAATTTTTTTTATTATGG - Intronic
1080842340 11:35996356-35996378 ATGAAGTTGTTGTCTTATATGGG + Intronic
1081237404 11:40661973-40661995 ATGAGGAAGCTGTCATATTAGGG + Intronic
1083411246 11:62493873-62493895 ATGAAGAATTTGCTTCATTATGG - Intronic
1085936855 11:81156596-81156618 ATGAACAAGTTGGCTTATCAAGG + Intergenic
1086772381 11:90783290-90783312 ATGCAGAAGTTTTCTAATGAGGG - Intergenic
1086812854 11:91332373-91332395 ATGAAGAAGTTCTCTTAATGTGG - Intergenic
1086836466 11:91630245-91630267 ATGCATAAGTTATTTTATTAAGG - Intergenic
1087011620 11:93519670-93519692 AGCAAGAAGGTGGCTTATTATGG + Intronic
1087074165 11:94113629-94113651 CTGAACAACTTGTCTTACTAAGG - Exonic
1087654671 11:100907769-100907791 AGGAAGAAGAAGTCTAATTAGGG + Intronic
1089648816 11:119898314-119898336 ATGAATAAATAGTCTTATAAAGG - Intergenic
1090229523 11:125091637-125091659 TTGAAGAACTTGTCTAGTTAGGG + Intergenic
1091513292 12:1152228-1152250 AAGATGAAGATGTCTTAATATGG + Intronic
1092949328 12:13486724-13486746 AAGGAGAAGTTTTCTTAATAGGG + Intergenic
1093546773 12:20357950-20357972 ATGTAGAAGTCGTCCTTTTATGG - Intergenic
1093627531 12:21366777-21366799 TTGTAGAAGTTGTTTTTTTATGG + Intronic
1093862838 12:24188899-24188921 ATGAAGCAGTTGTGTAGTTATGG + Intergenic
1094042555 12:26133092-26133114 ATGAGGAAGTTGTCCTTTTCAGG - Intronic
1094252534 12:28380582-28380604 ATGAATAAATAATCTTATTATGG - Intronic
1095220110 12:39601521-39601543 ATGAAGAAGTTGTCTTATTATGG + Intronic
1095341223 12:41091148-41091170 TTAAAAAAGTAGTCTTATTATGG + Intergenic
1097391227 12:59016540-59016562 ATGAAGAAATTGTTTTATAATGG + Intergenic
1097926297 12:65131697-65131719 ATGAAAAAGTTTTCATTTTAAGG - Intergenic
1098221622 12:68275932-68275954 ATTAAGAAGTTTCCTTATTGCGG - Intronic
1100688563 12:97013353-97013375 AGGAAGGAGTTGTCTTACCAGGG + Intergenic
1102011244 12:109619884-109619906 AGGAAGAAGTTGACTTTTGAAGG + Intergenic
1102411365 12:112722473-112722495 ATGAAGAAGTAGACTGAATATGG - Intronic
1103873693 12:124110607-124110629 AGGAAGAAGTTGTTTCATTTAGG + Intronic
1104495114 12:129229952-129229974 ATTAAGAAGTTGTCTGGTGAAGG - Intronic
1106745201 13:32696796-32696818 ATGATGAAGTTTTCTTGTTAGGG + Intronic
1106777395 13:33021390-33021412 ATGAAGAAGTTTTCAGAATAAGG + Intronic
1106880774 13:34127820-34127842 CTGAAATAGTTGGCTTATTAAGG + Intergenic
1106946109 13:34829613-34829635 ATGAAGGAATTCTCTTATGAAGG + Intergenic
1107899531 13:44998103-44998125 TTGAGGAAGTTCTCTTATGATGG - Intronic
1108959187 13:56202168-56202190 ATTAAGAAGTTGTATGATTCTGG + Intergenic
1109945856 13:69430817-69430839 GTTAAGAAGCTGTGTTATTAAGG - Intergenic
1110546216 13:76758583-76758605 ATGATTAAGTTATCTAATTATGG + Intergenic
1110700354 13:78540280-78540302 ATTAAGTAGTTGTGTTACTATGG - Intergenic
1111423358 13:88047130-88047152 ATGAAGAAAATGTTTTATTCAGG + Intergenic
1112098387 13:96160263-96160285 CTGAAGAGGTTGACTTAATATGG + Intronic
1112641839 13:101284108-101284130 ATCAAAAATTTGTCTTCTTATGG + Intronic
1114682645 14:24499265-24499287 AAGAGGAAGTTGTCTTCTTTGGG + Intergenic
1115008551 14:28516543-28516565 ATGAAGAAGCTGTTTCATAAAGG - Intergenic
1116036080 14:39628588-39628610 ATGAAGAAGTTGAAATATTAAGG + Intergenic
1116863884 14:50015921-50015943 AGGAAGAAGTTGCCATATGAGGG + Intergenic
1117010579 14:51467314-51467336 CAGAAGAATTTTTCTTATTACGG + Intergenic
1117567862 14:57014748-57014770 GTGAAGAGGATGTGTTATTAAGG + Intergenic
1122101278 14:99412296-99412318 AGGAGGAAGTTGTATTATTATGG - Intronic
1125261005 15:37824599-37824621 ATGAATTAGTTGTTTTTTTAAGG + Intergenic
1125873974 15:43127639-43127661 ATGCAGAAATTGTCTTTTTTTGG - Intronic
1126607004 15:50488203-50488225 ATGAAGATGTTTTCTTCTTAAGG + Intronic
1128282284 15:66406183-66406205 TGGAAAAAGATGTCTTATTATGG + Intronic
1128648542 15:69394398-69394420 GTGTAGGAGTTGTCTTATTTTGG - Intronic
1131426379 15:92348345-92348367 AAGAGCAAGTTGTCTTATTCTGG + Intergenic
1132438398 15:101832963-101832985 ATGAAGAAGAAGTCTCATTTAGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1134376764 16:13683358-13683380 TTGAAGAAATTGTGTTATTTTGG + Intergenic
1134909237 16:18009254-18009276 ATGAATAAGTTATCATATAAAGG + Intergenic
1135665188 16:24329635-24329657 ATGAAGAAAGTGTCACATTAGGG + Intronic
1137931015 16:52587826-52587848 ATGAAGAAGATGCCATATTGTGG + Intergenic
1138159779 16:54742171-54742193 ATGAAGAACTTCTCTGAGTAAGG + Intergenic
1140992943 16:80231924-80231946 AAGAAGCAGTTGTGTTTTTAAGG - Intergenic
1141303991 16:82844055-82844077 ATGAGGATGTAGACTTATTACGG - Intronic
1141342722 16:83217971-83217993 CTGAAGAAGTTGTGTTATATGGG + Intronic
1144815534 17:18031826-18031848 AAGATGATGTTGTCTTACTATGG + Intronic
1149258219 17:54851034-54851056 ATGAAGCAGATGACTTGTTAGGG - Intergenic
1156189550 18:34702442-34702464 ATCTAGCAGTTGTCTTATGAAGG - Intronic
1158381860 18:56940713-56940735 ATGAGGAAGCAGTTTTATTAGGG + Intronic
1159505121 18:69326682-69326704 ATGAAGAATGTGTTTTAATAAGG - Intergenic
1159589092 18:70312582-70312604 ATGAAGAGGTTATCTTGTTTTGG + Intronic
1164187357 19:22882083-22882105 AGGAAGAAGCTGTCTTGTTGAGG - Intergenic
1164915600 19:32049955-32049977 ATGAAAATTTTGTCTTATGAAGG - Intergenic
1167229995 19:48276491-48276513 CTGAATCAGTTGTTTTATTAAGG + Intronic
1167809944 19:51820790-51820812 ATGAGGAAGTTGACTTATATTGG - Intronic
927270370 2:21202417-21202439 ATTATGAAGTTATCTTATTAAGG - Intergenic
927584784 2:24292272-24292294 ATGTAGAATATGTCTTATTGAGG - Intronic
928509464 2:31988733-31988755 ATTAAGAAGTTGTATACTTAAGG - Intronic
928614199 2:33020084-33020106 ATGAAGAAGTTGTTTCTTTTTGG + Intronic
930885989 2:56327449-56327471 AAGAAGAAGTTATTTTATTGGGG - Intronic
931532745 2:63234703-63234725 ATGAATATTTTGTCTTATTCAGG + Intronic
932615666 2:73229893-73229915 AGGGACAAGTTGTCTTTTTAGGG - Intronic
932933143 2:76066591-76066613 CTGAAGAATTTGACTTTTTAGGG + Intergenic
933863956 2:86499313-86499335 ATGAATAAATGGTTTTATTAGGG + Intergenic
934784246 2:96993207-96993229 TTGACAAAGTTGTCTGATTAGGG + Intronic
936663853 2:114572354-114572376 ATAAACAAGTTGTATTATTTTGG - Intronic
938968668 2:136410975-136410997 ATGAGGTAGTACTCTTATTACGG + Intergenic
939346571 2:140973542-140973564 ATAAACAAGTTGGCTTTTTAGGG - Intronic
940689848 2:156902286-156902308 ATGCTGAAGTTTTCTTTTTAAGG + Intergenic
942195433 2:173513905-173513927 TAGAACAAGTTGTCTTATTCTGG + Intergenic
942661441 2:178269363-178269385 ATGAACAATTTGTCTTTTAATGG + Intronic
944379824 2:199095388-199095410 ATAAAGATGTTGTCTTAGAATGG - Intergenic
944381238 2:199113182-199113204 GTGAAGAATTTGTCTTTTAATGG - Intergenic
947191500 2:227510619-227510641 ATGAAGTATTTGTTTTATTTTGG + Intronic
947725370 2:232395724-232395746 ATTAATAAGTTGTTTTATTTAGG - Intergenic
1168812767 20:716907-716929 ATGAAGAAGTTGTATCAGTCTGG - Intergenic
1169599424 20:7240507-7240529 ATAAAGAAGATGTCTCATCATGG + Intergenic
1170224186 20:13973722-13973744 ATGATGAAGTTGTCTTTCCATGG + Intronic
1171537866 20:25913071-25913093 ATGAAGAGGTTAACTTTTTAGGG + Intergenic
1172351885 20:34249450-34249472 ATGAAGAAGTTTGCGGATTAGGG - Intronic
1172439161 20:34953487-34953509 AGGGAGAAGTCGTATTATTATGG - Intronic
1178159013 21:29889018-29889040 ATGAGGAAGTTGACTTCTCAAGG + Intronic
949520500 3:4848697-4848719 ATGAAGAATTAGTGTTATCAGGG + Intronic
949728932 3:7084441-7084463 AATAAGAAGTAGTCATATTAGGG + Intronic
951837108 3:26995751-26995773 TTGAAGAAGTTGTTTTATTTGGG + Intergenic
952207352 3:31193091-31193113 ATGAAGAACTTGTTTTACAAGGG - Intergenic
953604784 3:44404628-44404650 ATAATGAAGGTGTCTTACTAGGG - Intronic
955610733 3:60754131-60754153 ATGAAGAAGTTTTCTTATCCTGG - Intronic
955730152 3:61976613-61976635 ATGAAGTATTTGTTTTAATATGG + Intronic
956941544 3:74167764-74167786 ATGAAGAAATTGTCTTCTGCTGG + Intergenic
957581438 3:82078221-82078243 CTGAAGATGTTGTCTTCCTATGG + Intergenic
958039918 3:88214788-88214810 AGAAAAAAGTTGTCTTTTTAAGG - Intergenic
958450052 3:94261559-94261581 ATGCAAAACTTGTCATATTATGG - Intergenic
960038184 3:113122865-113122887 ATGAAGAAGCTGGATTATAATGG + Intergenic
962024272 3:131530667-131530689 ATGGAGAACTTGTCAAATTATGG - Intergenic
962160571 3:132995258-132995280 ATGAAACAGGTGTTTTATTAAGG - Intergenic
962680710 3:137796945-137796967 ATGAATCATTTCTCTTATTAGGG - Intergenic
963731775 3:148981723-148981745 TTGTAAAAGTTGTCTTATGAAGG + Intergenic
964749433 3:160040645-160040667 ATGTTGAAGTGGTCTTATTCTGG - Intergenic
964907868 3:161740512-161740534 GGGAAGAAGTTGTGTCATTAGGG + Intergenic
965252551 3:166361387-166361409 TTGAAGAAATTGTTTTATCAAGG + Intergenic
965499177 3:169436991-169437013 ATGAAGAAGTTATTTTGCTACGG + Intronic
967337484 3:188360655-188360677 AATAAGAAGTTGTCTAATTCAGG - Intronic
967648072 3:191950960-191950982 TTGAATAAGTTATTTTATTAGGG - Intergenic
967810101 3:193751946-193751968 AAGAATATGTTGTCTTCTTATGG + Intergenic
968015594 3:195329564-195329586 TTAAAGAAGTTGTGTTATGAAGG - Intronic
969179917 4:5432105-5432127 GTCAATAAGTTGTCTCATTATGG + Intronic
969710040 4:8837526-8837548 ATTAAGAAGTTGCCTTAGGAAGG + Intergenic
970466706 4:16330969-16330991 ATGAATAATTTGTCTTAACAAGG + Intergenic
970486946 4:16534328-16534350 ATGAACAAGATGGCTTAGTAGGG + Intronic
971378048 4:26070838-26070860 AGGAAGGAGTTGTCCTAATATGG + Intergenic
971733311 4:30414338-30414360 ATGAAGAAATTGTAAGATTAGGG + Intergenic
972031735 4:34468594-34468616 ATGAAGAGGTTTTTTTACTATGG + Intergenic
973855114 4:55003464-55003486 CTGAAGGAGTTGTCTCATGAAGG - Intergenic
974388892 4:61238942-61238964 ATAAATAAGTTCTCTTATTCCGG + Intronic
975320860 4:73009253-73009275 ATATACAAGTTGTCTCATTAAGG + Intergenic
976571379 4:86615785-86615807 TGGAAGAAGTAGTCTTTTTATGG - Intronic
977342728 4:95779773-95779795 ATGGAGAAGTTGTTTCATAAGGG - Intergenic
977605415 4:98979888-98979910 ATGAAGAAATTGTCGTATATTGG + Intergenic
978995419 4:115144742-115144764 ATGAAGAAATTGTCTATTCAAGG + Intergenic
979040442 4:115785153-115785175 ATGAAGAAATTGACATATAAAGG - Intergenic
980286750 4:130789116-130789138 AGGAAAAAGTTGTCTTATTGGGG + Intergenic
980623419 4:135341103-135341125 TTTAAGACATTGTCTTATTATGG - Intergenic
981012628 4:139941442-139941464 ATTAAGAAGTTGTCTTCCTAAGG + Intronic
981025185 4:140070737-140070759 ATGAAGAAGTTGCCTTAGGTAGG - Intronic
981485840 4:145285194-145285216 ATGAAGAAGCTTTCTTCTTTGGG - Intergenic
983074492 4:163308810-163308832 TTGAGGAAGATGTATTATTATGG - Intergenic
983449293 4:167890747-167890769 GTGAAGAAGTTGTATAATAAAGG + Intergenic
983536024 4:168858100-168858122 TTGAAGAAGTTTTCCTAATAAGG + Intronic
984625257 4:181999749-181999771 ATGAAGATGTTTTGTTATTATGG + Intergenic
987106943 5:14648603-14648625 ATAAAGAAGTTTTCTTTCTAAGG - Intergenic
987774905 5:22352434-22352456 ATGTAGAAGTTGTCTTCTGACGG + Intronic
987837845 5:23184861-23184883 ATGATAAAGTTGTATTAATATGG - Intergenic
990720151 5:58685531-58685553 ATGAATATGTGGTCTTATTTGGG - Intronic
991065720 5:62422597-62422619 ATGTATAACTTTTCTTATTAGGG + Intronic
991476345 5:67024149-67024171 ATGTAGTAGTTGTCTTTTTGTGG + Intronic
992498127 5:77313067-77313089 AGGAAGAAGTTAACTTATTTAGG - Intronic
993140288 5:84024779-84024801 AGAAAGAAGTTGTGTTCTTAAGG - Intronic
993933507 5:93972090-93972112 CTCAAGAAGTTGTCTCTTTAAGG - Intronic
995606650 5:113863892-113863914 ATGAAGTAGTTTTTTTTTTAAGG + Intergenic
995888365 5:116921250-116921272 ATGAAAAAGTTTTCTTCTAATGG - Intergenic
996252395 5:121352428-121352450 TTGAATAAGTTGTCTTCTTACGG - Intergenic
996981124 5:129496264-129496286 ATTAAGAAATTTACTTATTATGG - Intronic
997310730 5:132879021-132879043 ATTGAGAAGTTGTCCTCTTATGG + Exonic
997432138 5:133847984-133848006 ATGATGAAGTTGTCTTAGGCTGG - Intergenic
998939282 5:147263040-147263062 AAGAAGAAGTTTTCTTAGTGGGG + Intronic
1000494464 5:161963355-161963377 ATAAAGTAGGTGTGTTATTATGG + Intergenic
1000669731 5:164046072-164046094 AGGTAGAAGTTGTCTCATCAAGG - Intergenic
1004052038 6:12092974-12092996 ATGAAGTATTTGCCTTATTTGGG + Intronic
1007423250 6:41732242-41732264 TTGAAGAAGTGGTCTTCTTTAGG + Intronic
1007884117 6:45206167-45206189 ATGAAGAACATGTGTTAGTAAGG + Intronic
1008359110 6:50593687-50593709 TTCAAGAAGTTGTCTTATGTTGG + Intergenic
1009882034 6:69580585-69580607 TAGAAGATGTTGTATTATTATGG - Intergenic
1011967334 6:93175249-93175271 ATGATTAATTTGTCTTTTTATGG + Intergenic
1012026561 6:94001276-94001298 ATAAAGAAGTTGGCTTCTGATGG - Intergenic
1012731114 6:102882762-102882784 ATGTGGTAGCTGTCTTATTAAGG - Intergenic
1012977483 6:105795695-105795717 AGGAAGAAGATGTATCATTATGG - Intergenic
1013697003 6:112715525-112715547 ATGCAGGTGTTGTCTTATGAGGG - Intergenic
1014107274 6:117581339-117581361 ATGAAGAAGTTTTATTAATAGGG - Intronic
1014674990 6:124353221-124353243 ATTAAGAAGTAGTATTTTTAAGG + Intronic
1014894164 6:126880868-126880890 ATGAAAAGATTGTCTTATTGTGG + Intergenic
1016541331 6:145169630-145169652 ATAAAGAACTTATGTTATTAGGG - Intergenic
1019818538 7:3220099-3220121 ATGAATAAGTTGTTTTAAGAAGG + Intergenic
1020145114 7:5636306-5636328 ATAAAGAAGGTGTCTTCTTTAGG - Intronic
1020942622 7:14560452-14560474 ATGAAGTAGTTGTCTTTCTGTGG + Intronic
1021195157 7:17666497-17666519 CTGAAGAAGTTATATTTTTAAGG + Intergenic
1021727218 7:23559775-23559797 GGTAAGATGTTGTCTTATTATGG + Intergenic
1022632955 7:32102806-32102828 ATGGAGAAGCTGGTTTATTATGG + Intronic
1022679787 7:32533412-32533434 ATGAAAATGTTGTCATATTGAGG + Intronic
1022954344 7:35367527-35367549 TTGAAGAAGCTGTGTTTTTAGGG - Intergenic
1023498010 7:40818454-40818476 ATGAAGAAGTAGTCATGTTCTGG - Intronic
1023732743 7:43207905-43207927 TTAAAGTAGTTGTCTTTTTATGG + Intronic
1024319180 7:48048247-48048269 GTGATGGTGTTGTCTTATTAGGG - Intronic
1027776785 7:82475182-82475204 ATGAAGATGGTGTCTTCTTCTGG + Intergenic
1027860016 7:83565854-83565876 ATTAAGAAGCTGTCTTGTGATGG - Intronic
1028082466 7:86595190-86595212 ACTAAGAATTTGTCTGATTAAGG + Intergenic
1030423938 7:109347625-109347647 ATGAAGAAGTTGTCTTAAATAGG + Intergenic
1031575982 7:123416442-123416464 ATGAAGAATTTGGTTTATTTTGG + Intergenic
1031712256 7:125063664-125063686 TTGAAGAAGATGTTTTATTAGGG + Intergenic
1032651072 7:133879066-133879088 TTGAATCAGTTGTTTTATTAGGG + Intronic
1032982663 7:137302098-137302120 ATAAATAAGGTGACTTATTAGGG - Intronic
1034989317 7:155538177-155538199 CTGAAGTAATTTTCTTATTAAGG + Intergenic
1041114146 8:54517940-54517962 ATGAGGAAGTTGTCTCAGTTTGG + Intergenic
1041728748 8:61043773-61043795 CTGAAGAATTTATCTTACTAAGG - Intergenic
1041879686 8:62735609-62735631 ATTCAGAAGGTGTATTATTAAGG - Intronic
1042074113 8:64969119-64969141 ATAAAGAAATTGTCTTATTTTGG - Intergenic
1043240154 8:77923098-77923120 ATCAGTAAGTTCTCTTATTATGG - Intergenic
1044893843 8:96866481-96866503 AAGCAGAAATTATCTTATTACGG + Intronic
1046021044 8:108665288-108665310 GTGAAGAAGTTGTCTAATGAGGG + Intronic
1046132581 8:109985295-109985317 ATGAAGCAGTTGTCATTTTGTGG - Intergenic
1046298974 8:112260548-112260570 ATCAAGAAGTTATCTTGATATGG - Intronic
1046504406 8:115118448-115118470 ATTAAGAATTAATCTTATTAAGG - Intergenic
1047009274 8:120653737-120653759 GTTAAAAAGTTGTCTTCTTAGGG + Intronic
1048063746 8:130947391-130947413 ATTTACAAGTTGTCTTCTTATGG - Intronic
1048430484 8:134365908-134365930 ATGAAGCAGTGGTGTTATTTAGG - Intergenic
1048933693 8:139338065-139338087 CTGAAGAAGTTATCTTCCTACGG - Intergenic
1048941792 8:139406262-139406284 ATGCAGAGGGTGCCTTATTAGGG + Intergenic
1050416702 9:5426061-5426083 TAGAAGATGTTGTCTTTTTAGGG - Intronic
1052769093 9:32671161-32671183 ATGAATCAGTTGTCTCATTCTGG - Intergenic
1053590552 9:39510144-39510166 ATGAAGATGATATCTTATTATGG - Intergenic
1053848413 9:42265533-42265555 ATGAAGATGATATCTTATTATGG - Intergenic
1054575750 9:66855145-66855167 ATGAAGATGATATCTTATTATGG + Intergenic
1055089716 9:72350717-72350739 AGGAAGAACTTTTCTCATTAGGG + Intergenic
1055262850 9:74459025-74459047 ATGAGGCATTTGTCTTATTTAGG - Intergenic
1055966031 9:81866158-81866180 ATGAAGAAGAGGTCTTCTTGTGG + Intergenic
1056272599 9:84961117-84961139 AGGAGGAAATTTTCTTATTATGG - Intronic
1058137518 9:101323496-101323518 GTGAAGAAGTTATCCTATTTTGG + Intronic
1059538244 9:115104343-115104365 ATTCAGAAGTTCTCTTATTTAGG - Intronic
1060573732 9:124668985-124669007 ATGTATAATTTGTCTTCTTAGGG - Intronic
1060638099 9:125215660-125215682 ATGGAGAAGTTATGATATTATGG - Intronic
1188520141 X:31029751-31029773 GTGAAGAAGCTCTTTTATTAAGG + Intergenic
1189575412 X:42347495-42347517 ATGAAGATGTTCTCTGATGAAGG - Intergenic
1189785351 X:44554487-44554509 ATGAACAAGGTGGCTTATTGTGG + Intergenic
1192655381 X:72987944-72987966 AGGATGGATTTGTCTTATTATGG + Intergenic
1194024082 X:88729837-88729859 TTGTAGGAGTTGTTTTATTATGG - Intergenic
1195580970 X:106502252-106502274 ATGAAGAACTATTGTTATTATGG - Intergenic
1195751752 X:108166535-108166557 ATGCTGAATTTCTCTTATTAAGG + Intronic
1197098357 X:122622060-122622082 ATGAATATGTTATATTATTATGG - Intergenic
1197499547 X:127227089-127227111 ATGGAGTAGTTATCTTATTTAGG + Intergenic
1198614933 X:138446459-138446481 AGGAAGAAATTGATTTATTAAGG + Intergenic
1201549728 Y:15207243-15207265 AGGAAGAAGTTATTTTATGATGG - Intergenic
1201713676 Y:17019625-17019647 ATGAATAAATTGTTTTATTAAGG + Intergenic
1202625738 Y:56855645-56855667 TTGAAGATGTTGTCTGTTTACGG + Intergenic