ID: 1095221337

View in Genome Browser
Species Human (GRCh38)
Location 12:39619846-39619868
Sequence CTCCCTCCCAGGCCCCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095221333_1095221337 18 Left 1095221333 12:39619805-39619827 CCGGGAATGATTCTCTCAGAAGC 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1095221337 12:39619846-39619868 CTCCCTCCCAGGCCCCTCATTGG 0: 1
1: 0
2: 2
3: 41
4: 380
1095221332_1095221337 30 Left 1095221332 12:39619793-39619815 CCGCTGCATCTACCGGGAATGAT 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1095221337 12:39619846-39619868 CTCCCTCCCAGGCCCCTCATTGG 0: 1
1: 0
2: 2
3: 41
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095221337 Original CRISPR CTCCCTCCCAGGCCCCTCAT TGG Intergenic