ID: 1095221337 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:39619846-39619868 |
| Sequence | CTCCCTCCCAGGCCCCTCAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 424 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 41, 4: 380} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1095221333_1095221337 | 18 | Left | 1095221333 | 12:39619805-39619827 | CCGGGAATGATTCTCTCAGAAGC | 0: 1 1: 0 2: 1 3: 15 4: 152 |
||
| Right | 1095221337 | 12:39619846-39619868 | CTCCCTCCCAGGCCCCTCATTGG | 0: 1 1: 0 2: 2 3: 41 4: 380 |
||||
| 1095221332_1095221337 | 30 | Left | 1095221332 | 12:39619793-39619815 | CCGCTGCATCTACCGGGAATGAT | 0: 1 1: 0 2: 0 3: 3 4: 56 |
||
| Right | 1095221337 | 12:39619846-39619868 | CTCCCTCCCAGGCCCCTCATTGG | 0: 1 1: 0 2: 2 3: 41 4: 380 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1095221337 | Original CRISPR | CTCCCTCCCAGGCCCCTCAT TGG | Intergenic | ||