ID: 1095230717

View in Genome Browser
Species Human (GRCh38)
Location 12:39735952-39735974
Sequence TTGGAGAAACACTGCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 8, 3: 55, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095230712_1095230717 24 Left 1095230712 12:39735905-39735927 CCCAGTATGATTCATAGGAGACC 0: 1
1: 0
2: 1
3: 9
4: 80
Right 1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG 0: 1
1: 0
2: 8
3: 55
4: 252
1095230711_1095230717 25 Left 1095230711 12:39735904-39735926 CCCCAGTATGATTCATAGGAGAC 0: 1
1: 0
2: 1
3: 13
4: 88
Right 1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG 0: 1
1: 0
2: 8
3: 55
4: 252
1095230715_1095230717 2 Left 1095230715 12:39735927-39735949 CCACAAAGCTTTAAGAGAAGTAT 0: 1
1: 0
2: 0
3: 21
4: 265
Right 1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG 0: 1
1: 0
2: 8
3: 55
4: 252
1095230713_1095230717 23 Left 1095230713 12:39735906-39735928 CCAGTATGATTCATAGGAGACCC 0: 1
1: 0
2: 2
3: 7
4: 75
Right 1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG 0: 1
1: 0
2: 8
3: 55
4: 252
1095230714_1095230717 3 Left 1095230714 12:39735926-39735948 CCCACAAAGCTTTAAGAGAAGTA 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG 0: 1
1: 0
2: 8
3: 55
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095230717 Original CRISPR TTGGAGAAACACTGCCAGCT TGG Intronic
901696718 1:11013024-11013046 TTCGAGGGACGCTGCCAGCTTGG + Intronic
902178828 1:14672121-14672143 TTAGACAAATTCTGCCAGCTTGG - Intronic
905999339 1:42410466-42410488 TTGGAGAAAAACTCCCATCTGGG + Intronic
907838477 1:58133788-58133810 TTGCAGAAGGACAGCCAGCTTGG + Intronic
908142291 1:61198794-61198816 ATGGCGACACACTGACAGCTGGG - Intronic
908720416 1:67119688-67119710 CAGCAGAAACACTGCCAGCTGGG + Intronic
910071527 1:83220120-83220142 ATGGAGTAACACTGCCAACTTGG + Intergenic
910098042 1:83547033-83547055 TTGGAGAAACTTTTCCAGCTGGG - Intergenic
914840420 1:151243763-151243785 CAGTAGAAACACTGCCATCTTGG - Intronic
916689562 1:167177295-167177317 CAGCAGAAACACTGCCAGCTGGG - Intergenic
916847643 1:168669738-168669760 CAGTAGAAACACTGCCAGCTTGG + Intergenic
917538213 1:175889731-175889753 TTGAAGAAACCCTCCCAGCAGGG + Intergenic
918294241 1:183140876-183140898 TTGAAGATATATTGCCAGCTAGG + Intronic
918804408 1:189020836-189020858 TTTAACAAACACTGTCAGCTGGG + Intergenic
920697152 1:208189635-208189657 TTGGAGCAACGCTGCAAGGTAGG + Intronic
922303406 1:224323519-224323541 CAACAGAAACACTGCCAGCTTGG + Intronic
924507676 1:244701413-244701435 TAGCAGAAACACTGCCAGCTTGG + Intronic
1063377268 10:5561810-5561832 TTGGAGTCACTCTGCCATCTTGG - Intergenic
1065730969 10:28709300-28709322 TTGGAGAAGCAGTTCCAGCTGGG + Intergenic
1065781145 10:29168984-29169006 CAGAAGAAACACTGCCAGGTTGG - Intergenic
1066652028 10:37665440-37665462 CAACAGAAACACTGCCAGCTTGG - Intergenic
1067825356 10:49568248-49568270 TGGCAGAAACACTACCAGCTTGG - Intergenic
1069233484 10:66041188-66041210 TTGCAGAATAACTGCCAGTTGGG - Intronic
1069536204 10:69255290-69255312 TTAGAGAGACACTCCCAACTGGG - Intronic
1070070145 10:73080288-73080310 TTTGAGAAGCACTGCCATATAGG - Intronic
1072058215 10:91781959-91781981 CAGCAGAAACACTGCCAGCCTGG - Intergenic
1073255135 10:102146226-102146248 TTGAAGAAACTTTGCCAGATTGG + Intronic
1074686074 10:115963588-115963610 TTGGGGAAACTTTCCCAGCTTGG - Intergenic
1076808240 10:132870422-132870444 GTGGAGACAGACTGCAAGCTCGG + Intronic
1077611015 11:3642995-3643017 TTTGAGAAATGCTGCCTGCTGGG + Intergenic
1080491647 11:32771155-32771177 TGGCAGCAGCACTGCCAGCTTGG + Intronic
1080806457 11:35658651-35658673 TGGCAGAAGCACTGCCAGCATGG + Intergenic
1081108949 11:39107580-39107602 TAGCAGAAACACTGCCAACATGG - Intergenic
1082214836 11:49557173-49557195 ATGGAGAAAAACTGGGAGCTTGG + Intergenic
1083312947 11:61794590-61794612 TTTGGGAAACACTGCTATCTGGG + Intronic
1083533184 11:63444108-63444130 CAGGAGAAACACTACCAGTTTGG - Intergenic
1084027729 11:66462990-66463012 TGGCAGAAACACTGACAACTTGG + Intronic
1084694321 11:70744680-70744702 TTGGAGAAACGCTGGCACTTCGG - Intronic
1086634748 11:89067293-89067315 TTGGAGAAAAACTGGGAGCTTGG - Intergenic
1087052894 11:93904311-93904333 TTGGAGAGACCCAGGCAGCTGGG + Intergenic
1088853318 11:113723539-113723561 TTGAAGGAACTCTACCAGCTTGG + Intergenic
1089647038 11:119887097-119887119 TTTGAGGAACACGGGCAGCTGGG + Intergenic
1089784584 11:120898877-120898899 TTGGAGGCACCCTGTCAGCTGGG + Intronic
1089913340 11:122126177-122126199 TTGAAGAAACACTGACCTCTGGG - Intergenic
1090994424 11:131852595-131852617 GTGGAGTAACAGTGCCTGCTGGG + Intronic
1092631416 12:10381856-10381878 TTAGAGAAAAACTGCCTGCTTGG + Intronic
1095215764 12:39545520-39545542 TTGGAGAAAGACTGCTTGGTGGG - Intergenic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1097788015 12:63782542-63782564 GAGCAGAAACGCTGCCAGCTTGG - Intronic
1098250113 12:68560605-68560627 TAGCAGGAAAACTGCCAGCTGGG + Intergenic
1098709561 12:73738383-73738405 CAGCAGAAACACTGCCAACTGGG + Intergenic
1098835509 12:75419898-75419920 TTGCAGAAAGACAGCCAGATGGG + Intronic
1098946107 12:76591566-76591588 CTGCAGAAACAGTGCCAACTTGG + Intergenic
1099086383 12:78251683-78251705 CTGGAGCCACACTGCCAGCTTGG + Intergenic
1099122771 12:78712407-78712429 CAGTAGAAACACTGCCAGCTGGG - Intergenic
1099782596 12:87216447-87216469 GAGGAGAAAAACTGGCAGCTTGG + Intergenic
1100939738 12:99713027-99713049 CAGCAGAAACACTGCCAGCTTGG - Intronic
1102565009 12:113791073-113791095 TTGCAGAAAGACTGCTTGCTGGG - Intergenic
1103160314 12:118723689-118723711 CTGGAGAAACACTGGGAGCCAGG + Intergenic
1103886972 12:124209568-124209590 TTTGAGAATCACTGCCAACGAGG - Intronic
1105302403 13:19147875-19147897 CAGCATAAACACTGCCAGCTTGG - Intergenic
1107891029 13:44914610-44914632 TTGGAAAAACACTGACTACTTGG - Intergenic
1108729582 13:53220403-53220425 CGGTAGAAACACTGCCAGCATGG - Intergenic
1109066887 13:57706639-57706661 TAGCAGAAACATTGCCAACTTGG - Intronic
1109403174 13:61861754-61861776 TTGGAGAAACATTGCCAGGTGGG + Intergenic
1109790677 13:67243118-67243140 TTTGAGAAACATTGCCATCCAGG + Intergenic
1109819459 13:67634040-67634062 TAGTAGAAACATTGCTAGCTTGG + Intergenic
1110379199 13:74830420-74830442 TTGGGGAAAAAATGCCATCTGGG + Intergenic
1111208883 13:85050489-85050511 ATGGAGGAACACTGCCACCAGGG - Intergenic
1111573155 13:90114366-90114388 TTAAAGAAGCACTGCAAGCTTGG + Intergenic
1112086660 13:96039309-96039331 TATTAGAAACACTGTCAGCTTGG - Intronic
1112098107 13:96157868-96157890 TTGGAGACGCACTGTGAGCTAGG + Intronic
1113229677 13:108198772-108198794 TAGCATAAACACTACCAGCTTGG - Intergenic
1117011319 14:51473411-51473433 CTGGAGAAACACTGTCTGCCAGG - Intergenic
1118445382 14:65846338-65846360 TGGAAGAAACACTTCCAGATTGG - Intergenic
1119706861 14:76788477-76788499 TTGGAGGCACAGGGCCAGCTGGG + Exonic
1121039496 14:90733610-90733632 GTGGATAAACACTTCCAGCGAGG + Intronic
1122750650 14:103930087-103930109 TGGGAGAAGTACTTCCAGCTTGG + Intronic
1122885642 14:104709189-104709211 GTGGGGAAACCCTGCCAGGTGGG + Intronic
1124205139 15:27712023-27712045 CAGCAGAAACAGTGCCAGCTTGG + Intergenic
1126642365 15:50840972-50840994 CAGCAGAAACACTGCCAGCTGGG - Intergenic
1127825099 15:62696129-62696151 ATGGAGAAACACTGCAGTCTAGG - Intronic
1127881967 15:63166142-63166164 TTACAAAAACACTGCCAGCTGGG - Intergenic
1128676032 15:69609246-69609268 TTGAAAAACAACTGCCAGCTGGG - Intergenic
1130019159 15:80212737-80212759 CAGCAGAAACACTGCCAGCTTGG + Intergenic
1133264136 16:4573135-4573157 TTGGAGAAACCATGCCTTCTCGG + Intronic
1135181945 16:20282559-20282581 TTAGAGAAACACTGGCCTCTTGG - Intergenic
1136054178 16:27675721-27675743 CAGGAGAAATACTGCCAGCTTGG - Intronic
1136384574 16:29915257-29915279 TGGCAGAGACACTGCCAGCTTGG - Intronic
1139661124 16:68421527-68421549 TTGCACAAACACTGCCAGGTTGG - Intronic
1141212485 16:81994366-81994388 TTAGAGAAACCCTTTCAGCTAGG - Exonic
1141371449 16:83490236-83490258 TTGGTTAAACACTTCCTGCTGGG - Intronic
1142996287 17:3762317-3762339 GTGGAGAAGCACTGCCTGGTGGG + Intronic
1143562498 17:7704237-7704259 TTGAAGAAATACTGCCAGCAGGG + Intergenic
1144711503 17:17404347-17404369 CTGGAGAAACACTCCCACCTCGG - Intergenic
1148142485 17:45338504-45338526 TTGGAGAAAAACAGGAAGCTGGG + Intergenic
1149473120 17:56935558-56935580 TTGGAGAACCACTGACATCGTGG - Intergenic
1149835714 17:59910092-59910114 TAGGAGAAACACTGGAACCTGGG + Intronic
1149948715 17:60960819-60960841 CTGCAGAAACACCGCCATCTTGG - Intronic
1150305170 17:64078706-64078728 TTGCAAAAACACTGTAAGCTGGG + Intronic
1152943882 17:83188088-83188110 CAGCAGAAACACTGCCAACTTGG + Intergenic
1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG + Intergenic
1156157523 18:34321134-34321156 TTGGAGCAGCACTGGCTGCTTGG + Intergenic
1156547281 18:37977173-37977195 TTAGTGAAGCACTGCCAGTTTGG + Intergenic
1156747264 18:40407277-40407299 TGGGAGGAACACTGCCACCCTGG - Intergenic
1157976611 18:52334940-52334962 CAGCAGAAACACTGCCAGATTGG - Intergenic
1161109163 19:2459567-2459589 TTGGAGAAACACTGCTGTATAGG - Intergenic
1161441732 19:4295607-4295629 TTGTGGAAAAACTGCCAACTGGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1164529599 19:29038242-29038264 TGGAAGAAACACTGCCACCAGGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
929586403 2:43117611-43117633 TAGCAGAAACACTTCCAGCTGGG - Intergenic
929912545 2:46102711-46102733 TTGTAGAATATCTGCCAGCTGGG + Intronic
930680567 2:54253498-54253520 TTGAAGAAACACTGCAATTTTGG - Exonic
930703138 2:54479419-54479441 TTGGAGCCACACTGCCTGGTTGG + Intronic
930988174 2:57615067-57615089 TCATAGAAACACTTCCAGCTTGG - Intergenic
932438906 2:71719492-71719514 CAGCAGAAATACTGCCAGCTTGG - Intergenic
936427606 2:112434326-112434348 TTGGAGACCCCCTGACAGCTGGG - Intronic
937480218 2:122250751-122250773 CTGCAGAAATGCTGCCAGCTTGG + Intergenic
937570888 2:123359714-123359736 TAGCAGAAACACTGCCAGCTTGG - Intergenic
938253038 2:129830949-129830971 GGGAAGAAATACTGCCAGCTTGG + Intergenic
938955222 2:136291018-136291040 TTGGAGAAATATTGCCAACCTGG - Intergenic
939835069 2:147119904-147119926 TAACAGAAACACTGCCAGCATGG - Intergenic
940811067 2:158243406-158243428 TATTAGAAACACTGCCAGCTTGG - Intronic
942842594 2:180380620-180380642 TAGCAGAAACACTGCCAGCTGGG + Intergenic
943520275 2:188940918-188940940 TTGGAGAAACCCAGCCAGTACGG - Intergenic
945077904 2:206058898-206058920 TTTGGGAAACACTGCCAGATGGG - Intronic
946245406 2:218384433-218384455 TTGGAGAAACATGGCCAGCAGGG - Intronic
946646647 2:221844538-221844560 CAGCAGAAACACTGCCAGTTTGG - Intergenic
947070895 2:226287133-226287155 TTGGGAATTCACTGCCAGCTGGG + Intergenic
947801562 2:232931682-232931704 CAGCAGAAACAGTGCCAGCTGGG + Intronic
1169153978 20:3313662-3313684 GAGCAGAAACACTGCCAGTTTGG + Intronic
1170498540 20:16950868-16950890 ATGCAGAAACACTGCCAACATGG + Intergenic
1173013359 20:39202335-39202357 TGGCAGAAACACTGCCTGCTAGG + Intergenic
1174014949 20:47480339-47480361 TTAGAGAATCACTGGGAGCTGGG + Intergenic
1174059584 20:47823234-47823256 TTGGAGGGATTCTGCCAGCTTGG + Intergenic
1174165943 20:48583698-48583720 GTGTACAAAAACTGCCAGCTGGG + Intergenic
1174565336 20:51460786-51460808 TTTGAGAAACACTGGCAACTGGG - Intronic
1176003090 20:62842916-62842938 TTGGGGAGACCCTGCCAGCAGGG + Intronic
1176374625 21:6080881-6080903 TTGGAGACCCCCTGACAGCTGGG + Intergenic
1179748850 21:43457364-43457386 TTGGAGACCCCCTGACAGCTGGG - Intergenic
1179898988 21:44379239-44379261 TTGCAGAGACACTGTCAGCCTGG + Intronic
1181101432 22:20542739-20542761 CAGCAGAAACACTGCCAGCTTGG - Intronic
1181446465 22:22979061-22979083 TTGGAGGAACAGTGCCAGGAAGG - Intergenic
1182888755 22:33798599-33798621 TTGGAGCAGCAGTGCCAGCGTGG - Intronic
1184202217 22:42978532-42978554 GAGGAGAAACACTGTCATCTGGG - Intronic
1185363600 22:50424005-50424027 TTTGACAAAAACTGCCAGGTTGG - Intronic
949615365 3:5748040-5748062 TTGGAGAAAAAATGACAACTTGG + Intergenic
952688153 3:36173156-36173178 AAGGAGAAACACTTCCAACTAGG - Intergenic
952908192 3:38157942-38157964 CTGGTGAAAAACTGACAGCTTGG - Intergenic
954101513 3:48376591-48376613 TGAGAGAAACACTGTCAGCTTGG + Intronic
954833808 3:53446887-53446909 TTGGAGAAACATGGCCAAATAGG - Intergenic
955788591 3:62565425-62565447 TTGGAGAAACACTGCCTTGGAGG - Intronic
955903194 3:63779139-63779161 TTGGAGAAATACTACCTCCTAGG - Intergenic
956084761 3:65597583-65597605 GGGGAGAAACCCGGCCAGCTTGG - Intronic
956799780 3:72746542-72746564 TAGGAGAAACACTGCCGACACGG + Intergenic
956916726 3:73879838-73879860 TTGGTGAAACACTCATAGCTGGG + Intergenic
957510629 3:81183213-81183235 TGGAAGAAGCACTGTCAGCTTGG - Intergenic
958924620 3:100144506-100144528 TTGGAGACAAACTGGGAGCTGGG - Intronic
959905630 3:111708369-111708391 TGGGAGAAGAACTGCCAGGTAGG + Exonic
962019496 3:131482836-131482858 ATGGAGAGACACTTCCTGCTAGG - Intronic
962729720 3:138269534-138269556 TTGGAATAAGACTGACAGCTTGG + Intronic
964169470 3:153752393-153752415 TTGGATAAACAATTCCAGTTAGG + Intergenic
964204477 3:154157586-154157608 TTGAAGTAACACAGCTAGCTAGG + Intronic
964897468 3:161614968-161614990 TAGCAGAAACACTGCCAGCTTGG - Intergenic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
966910907 3:184559484-184559506 CTGGACAAACACAGCCAGCCAGG - Intronic
967568537 3:191000043-191000065 TTTGAGAAACACTGAGAGGTTGG + Intergenic
968007459 3:195253107-195253129 TTGGAGAAAAGCGGGCAGCTGGG - Intronic
969147805 4:5139366-5139388 TTGGAGAGCCACTGCCAATTAGG + Intronic
970203063 4:13628452-13628474 TTGGACAAACACTAAGAGCTAGG + Intergenic
970315865 4:14827784-14827806 TTGCAGAATAACTGCCAGATGGG + Intergenic
970698575 4:18708265-18708287 CAGCAGAAATACTGCCAGCTGGG - Intergenic
971111397 4:23590011-23590033 CAGCAGAAACACTGCCAGCTGGG - Intergenic
972059277 4:34848197-34848219 ATGAAGAAACAAAGCCAGCTCGG + Intergenic
972908658 4:43785468-43785490 AAGCAGAAACACTGTCAGCTTGG + Intergenic
975570243 4:75809305-75809327 CAGCAGAAAAACTGCCAGCTTGG - Intronic
975621056 4:76297029-76297051 TGGAATAAAAACTGCCAGCTTGG + Intronic
976154088 4:82124111-82124133 TTTGAGAACCACTGCCCTCTAGG - Intergenic
977254219 4:94722426-94722448 TTGCAAAAGGACTGCCAGCTGGG + Intergenic
978513615 4:109548371-109548393 TAGCAGAAACACTGCAAGCAGGG - Intergenic
978886225 4:113769343-113769365 TTGCAGAACCACTGTCAGCCTGG + Intergenic
979423749 4:120538703-120538725 TTGGAGAAACACTTCATTCTAGG - Intergenic
979482071 4:121230867-121230889 TGGGACAAACATTGCCAGGTTGG - Intergenic
981228816 4:142328853-142328875 TTTGAGAAACACTGCCATGGTGG + Intronic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
985656746 5:1135847-1135869 TTTGACAAACAGTGCCAGCTTGG + Intergenic
986935975 5:12887084-12887106 TAGCAAAAACACTGCCAACTTGG - Intergenic
987712657 5:21522074-21522096 CAGGAGAAACACTGCCAGTTGGG - Intergenic
988301721 5:29438419-29438441 CAGGAGAAACACTGCCAGTTGGG + Intergenic
988506192 5:31825434-31825456 TTGGGGAAACAAGTCCAGCTAGG - Intronic
988869387 5:35372108-35372130 TTGGAGTAACACTGCAAGAATGG + Intergenic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
991763019 5:69941221-69941243 CAGGAGAAACACTGCCAGTTGGG - Intergenic
991784307 5:70176908-70176930 CAGGAGAAACACTGCCAGTTGGG + Intergenic
991842246 5:70816261-70816283 CAGGAGAAACACTGCCAGTTGGG - Intergenic
991876754 5:71177292-71177314 CAGGAGAAACACTGCCAGTTGGG + Intergenic
992215519 5:74521153-74521175 TTCAAGAAACAATGCCAGCTGGG - Intergenic
992747383 5:79833028-79833050 TTGGAGGAAGACTCCCAGATAGG - Intergenic
993227366 5:85184327-85184349 CAGCAGAAACACTGCCAACTTGG + Intergenic
993830219 5:92747017-92747039 TTGGAGAAAGACTAACAACTTGG - Intergenic
994080302 5:95701295-95701317 TAGTAAAAACACTGCTAGCTTGG + Intergenic
994425925 5:99587113-99587135 CAGCAGAAACACTGCTAGCTTGG + Intergenic
996615522 5:125436565-125436587 TGGCAGAAACACTGCCAGCTTGG - Intergenic
999639640 5:153659434-153659456 TTGGAGGACCACTGGCAGCCAGG - Intronic
1001679299 5:173544415-173544437 TTTGAGAACCACAGGCAGCTAGG - Intergenic
1001773930 5:174314780-174314802 TTCCAGAAACTCTGGCAGCTGGG - Intergenic
1001815449 5:174665070-174665092 CAGCAGAAACACTGCCAGTTTGG - Intergenic
1004268128 6:14167361-14167383 TTGCAGAAAAACTGCCAACCTGG - Intergenic
1007976160 6:46103604-46103626 TTGCAGAAAGAATGGCAGCTTGG - Intergenic
1009004996 6:57774317-57774339 CAGGAGAAACACTGCCAGTTGGG + Intergenic
1009603673 6:65837537-65837559 TTGGATAAACTCTGCCTTCTAGG - Intergenic
1012245501 6:96922055-96922077 TTGGGGAAACACTGAAAACTAGG - Intergenic
1013865751 6:114694376-114694398 TAGCAGAAACACTGCTACCTGGG + Intergenic
1014961819 6:127695555-127695577 CAGCAGAAAAACTGCCAGCTTGG - Intergenic
1018441863 6:163821125-163821147 TGGGAGAAACACTGACAGACAGG - Intergenic
1018680271 6:166258657-166258679 TCACAGAAACACTGCCAGCCTGG - Intergenic
1020650929 7:10875262-10875284 CTGGACAGACACTGGCAGCTAGG - Intergenic
1021032954 7:15761609-15761631 TTTGAGAAACACTGTCATTTTGG - Intergenic
1021796784 7:24263574-24263596 TGGGAGAAACACTGTTAGATTGG - Intergenic
1023940988 7:44768259-44768281 GTGTAGAAACACTAACAGCTGGG + Exonic
1025235321 7:57230758-57230780 TTGGAGGGATTCTGCCAGCTTGG - Intergenic
1027289239 7:76685070-76685092 ATGGAGTAACACTGCCAACTTGG + Intergenic
1030412399 7:109197967-109197989 TAGCAGAAACACTGCCAGCTTGG + Intergenic
1031439170 7:121772107-121772129 TTGGAGAAGCAGTGCCATATTGG - Intergenic
1032169147 7:129569821-129569843 CAGCAGAAATACTGCCAGCTTGG + Intergenic
1034348250 7:150399968-150399990 TTAGAGAAACACTGCCCGCAAGG + Intronic
1034848247 7:154467703-154467725 CTGTAGAAACATTGCCAGCTTGG - Intronic
1036429530 8:8677091-8677113 TAGAAGAAAGACTGCCAGCTTGG - Intergenic
1037131646 8:15413648-15413670 TAGCAGAAACACAGCCAGCCTGG - Intergenic
1038235786 8:25752890-25752912 TAGAAGAAACACTACCAGCTTGG + Intergenic
1039445347 8:37626940-37626962 TTTGATAGACACTGCCAGATAGG - Intergenic
1040526460 8:48229469-48229491 TTGGAGAAACAGGGCCAGGCAGG - Intergenic
1040858444 8:51974221-51974243 TGGGAGAAACACTTCCAAATTGG - Intergenic
1042841434 8:73127779-73127801 CTGCTGAAACACTTCCAGCTTGG - Intergenic
1043039820 8:75248979-75249001 CAGCAGAAATACTGCCAGCTTGG + Intergenic
1043139935 8:76575490-76575512 TTTGCTAAATACTGCCAGCTAGG - Intergenic
1043669585 8:82865370-82865392 GTGGACAACCACTTCCAGCTGGG - Intergenic
1044423525 8:92025580-92025602 TGGGACAAACCCGGCCAGCTGGG - Intronic
1045766196 8:105673570-105673592 TTTGGTGAACACTGCCAGCTAGG + Intronic
1046464018 8:114579213-114579235 TTTGAGAACCACTGGCATCTGGG - Intergenic
1046517883 8:115286926-115286948 TTTGAGAAACACTGCCATAGAGG + Intergenic
1047607329 8:126488335-126488357 GTCGAGAAAGACTACCAGCTGGG + Intergenic
1049691563 8:143963157-143963179 CAGCAGAAACACTGCCTGCTTGG + Intronic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1055900230 9:81225746-81225768 TTGCTGAAACAATGCCAGCTCGG + Intergenic
1056516153 9:87352436-87352458 AAGCAGAAACACTGCCAGTTTGG + Intergenic
1056905631 9:90645368-90645390 TTGTTAAAACACTTCCAGCTGGG + Intergenic
1057073340 9:92119513-92119535 CAGAAGAAACACTGTCAGCTTGG - Intergenic
1058513238 9:105742072-105742094 CAGAAGAAACACTGCCAGCTTGG + Intronic
1058850102 9:109003342-109003364 TGGCAGAAACACTATCAGCTTGG + Intronic
1059641826 9:116224592-116224614 TTGGAGAAACACTGTCCAATAGG + Intronic
1059876465 9:118640957-118640979 TTGGAGAGACAAGGCCAACTTGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186292202 X:8112643-8112665 TTGTAGAAACTATGCCAGCCAGG + Intergenic
1187529048 X:20080088-20080110 TTGTAGAAACACAGGAAGCTAGG - Intronic
1187736015 X:22304253-22304275 TTGGAGAGAGACTGCCATGTTGG + Intergenic
1189408688 X:40749910-40749932 CAGCAGAAATACTGCCAGCTTGG + Intergenic
1190224005 X:48531717-48531739 CAGCAGAAACACGGCCAGCTGGG - Intergenic
1190576490 X:51844833-51844855 CAGCAGAAACACTACCAGCTTGG + Intronic
1192487020 X:71536511-71536533 AAGGAGAAAAACTGGCAGCTGGG - Intronic
1195173972 X:102297219-102297241 TAGCAGAAACGCTGCCAGCCTGG + Intergenic
1195184893 X:102389874-102389896 TAGCAGAAACGCTGCCAGCCTGG - Intronic
1195426638 X:104739948-104739970 ATGGTGAAACACTGCTAGATGGG + Intronic
1195725050 X:107906313-107906335 TGGGAGGAACACTGCGAGCCTGG - Intronic
1195840395 X:109170100-109170122 TTTGAGAAACACTGCCATAATGG + Intergenic
1195907462 X:109859177-109859199 TTAGAGAAACTCTTCCAGGTTGG - Intergenic
1198031431 X:132757142-132757164 CTGGAGAAACCCTAACAGCTGGG + Intronic
1198485725 X:137085672-137085694 CTGGAGAAACACTAGCAGGTAGG + Intergenic
1199119592 X:144035916-144035938 TAGCAGAAATACTGCTAGCTGGG + Intergenic
1199172592 X:144748448-144748470 TTTGAGAAACACTGCCTGATAGG - Intergenic
1199432591 X:147777724-147777746 TTGTAGAAACACTGCCATGGTGG - Intergenic
1200354484 X:155534098-155534120 CAGCAGAAAAACTGCCAGCTGGG + Intronic