ID: 1095232338

View in Genome Browser
Species Human (GRCh38)
Location 12:39754400-39754422
Sequence CTAAGGTTCTTAACGTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095232338_1095232340 17 Left 1095232338 12:39754400-39754422 CCTGCTGACGTTAAGAACCTTAG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1095232340 12:39754440-39754462 GTAAGCCTTTGAATGACAGTAGG 0: 1
1: 0
2: 0
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095232338 Original CRISPR CTAAGGTTCTTAACGTCAGC AGG (reversed) Intronic
906327413 1:44855851-44855873 CTAAGATCCTCAAGGTCAGCTGG - Intronic
921080090 1:211732261-211732283 CTCAGGTGCTTAATGTCAGGTGG + Intergenic
1067550759 10:47234220-47234242 CCAAGTTTCTTAACTTCAGGTGG + Intergenic
1072010600 10:91299708-91299730 CTGTGGTTCTCAAAGTCAGCCGG + Intergenic
1078580006 11:12532164-12532186 CTGAGGTTCTCAAGGTCATCAGG - Intergenic
1079907101 11:26262146-26262168 ATAATGTTCTAAACGTAAGCTGG - Intergenic
1081162422 11:39766282-39766304 CTAAGGACCTTGACGTCAGTAGG - Intergenic
1091734834 12:2912198-2912220 GTAAAGTTCTTAAAGTCAGTTGG + Intronic
1095215585 12:39543682-39543704 CTAAGGTTCCAAACGTCAGATGG - Intergenic
1095232338 12:39754400-39754422 CTAAGGTTCTTAACGTCAGCAGG - Intronic
1110438740 13:75504448-75504470 CTATGGTTGTTAGCTTCAGCAGG + Intergenic
1111530644 13:89533029-89533051 CAAATGTTCTTAATGTCATCTGG + Intergenic
1134225633 16:12387730-12387752 TTAAGGGTCTTAAGGTCAGATGG - Intronic
1140191223 16:72818733-72818755 AGAAGGTTCTTAACTTCACCAGG - Intronic
1141871319 16:86788630-86788652 CTAACGTTCTGAGAGTCAGCGGG + Intergenic
1146332011 17:31935484-31935506 CAAAGGTTCTTAACTTGAACAGG + Intergenic
1150313723 17:64150762-64150784 CCGAGGTTCTGAACTTCAGCTGG - Intronic
1151132540 17:71912478-71912500 CTAAGTGTCTTCACTTCAGCAGG - Intergenic
1160764243 19:800228-800250 CAAAGATACTTAATGTCAGCCGG - Intronic
1165008469 19:32825120-32825142 CCAAGGTTCTTGACGTCACTGGG + Intronic
1166642592 19:44506669-44506691 CTCAGTTTCTTACTGTCAGCTGG - Intronic
925207742 2:2021542-2021564 CTAAGTTTCTTAAGATCAGAAGG - Intronic
939252194 2:139696414-139696436 CTAAGATTCTTAACATGAGGCGG + Intergenic
946055884 2:216901571-216901593 CTAAGGCTGTAAACGGCAGCAGG - Intergenic
1184788570 22:46684894-46684916 CTGAGATTCTGAATGTCAGCAGG + Exonic
979418633 4:120475828-120475850 CTAAGGTTTTTAATTTCACCAGG - Intergenic
980637876 4:135533029-135533051 CTAAGGTTATTAAATTAAGCTGG - Intergenic
985172235 4:187163899-187163921 CCAAGGTTCTTAATAACAGCAGG + Intergenic
991191866 5:63883935-63883957 CTAAAGTTCTTATCTTCTGCAGG + Intergenic
994603054 5:101932414-101932436 CTAAACTTCCTAAGGTCAGCAGG - Intergenic
995158343 5:108943379-108943401 ATAAGGTTCTTGAAGTCAGAAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1028277822 7:88879633-88879655 CTAATGTTCTTAATGTGAGTTGG - Intronic
1035912233 8:3580197-3580219 CTAAGTTTCTTGCCTTCAGCAGG + Intronic
1051388328 9:16535866-16535888 GTAGGGTTCTTAAGGGCAGCAGG - Intronic
1056939541 9:90943220-90943242 GGAAGGTTCTTAACATCAGCAGG - Intergenic
1200255979 X:154583441-154583463 CTAAAGTTCTTACCTTCAACAGG - Intergenic
1200261790 X:154620962-154620984 CTAAAGTTCTTACCTTCAACAGG + Intergenic