ID: 1095234333

View in Genome Browser
Species Human (GRCh38)
Location 12:39778365-39778387
Sequence TACAGCTGGCCCCCAAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095234333_1095234337 -6 Left 1095234333 12:39778365-39778387 CCAGCTCTTGGGGGCCAGCTGTA 0: 1
1: 0
2: 1
3: 25
4: 129
Right 1095234337 12:39778382-39778404 GCTGTAGGGATGACTCTTCCTGG 0: 2
1: 0
2: 0
3: 15
4: 131
1095234333_1095234342 28 Left 1095234333 12:39778365-39778387 CCAGCTCTTGGGGGCCAGCTGTA 0: 1
1: 0
2: 1
3: 25
4: 129
Right 1095234342 12:39778416-39778438 TCATATTCTAGTTGTCACAAAGG 0: 2
1: 0
2: 3
3: 19
4: 174
1095234333_1095234340 -3 Left 1095234333 12:39778365-39778387 CCAGCTCTTGGGGGCCAGCTGTA 0: 1
1: 0
2: 1
3: 25
4: 129
Right 1095234340 12:39778385-39778407 GTAGGGATGACTCTTCCTGGGGG 0: 2
1: 0
2: 1
3: 10
4: 133
1095234333_1095234339 -4 Left 1095234333 12:39778365-39778387 CCAGCTCTTGGGGGCCAGCTGTA 0: 1
1: 0
2: 1
3: 25
4: 129
Right 1095234339 12:39778384-39778406 TGTAGGGATGACTCTTCCTGGGG 0: 2
1: 0
2: 0
3: 7
4: 137
1095234333_1095234338 -5 Left 1095234333 12:39778365-39778387 CCAGCTCTTGGGGGCCAGCTGTA 0: 1
1: 0
2: 1
3: 25
4: 129
Right 1095234338 12:39778383-39778405 CTGTAGGGATGACTCTTCCTGGG 0: 2
1: 0
2: 2
3: 6
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095234333 Original CRISPR TACAGCTGGCCCCCAAGAGC TGG (reversed) Intronic
901325416 1:8362468-8362490 CAGAGGTGGCCCCCAAGAGTTGG + Intronic
902224915 1:14990710-14990732 AGCAGCTGACCCCCAAGACCTGG - Intronic
903474951 1:23613231-23613253 TGCAGCTGGGCCCCAGGTGCTGG + Intronic
904771692 1:32884675-32884697 CACAGCTGGCCCCCCAGGCCTGG + Intergenic
908330956 1:63070804-63070826 TACCACAGTCCCCCAAGAGCTGG + Intergenic
910956898 1:92716016-92716038 TACACCTTGCCCCCCAGAGGTGG - Intronic
916649076 1:166818112-166818134 AACAGCTGGCCCTTATGAGCAGG - Intergenic
918098019 1:181350343-181350365 TGCAGCTGCTCCCCAAGAACAGG + Intergenic
920065208 1:203264420-203264442 AACAGCTGCATCCCAAGAGCAGG - Intronic
921219477 1:212962882-212962904 CAGACCTGGACCCCAAGAGCTGG + Intronic
921890081 1:220344855-220344877 TTCTGCTGGCTCCCAAGAGAGGG + Intergenic
922607004 1:226895727-226895749 AACAGCTGGCACCAAAGAGCTGG - Exonic
923057430 1:230437526-230437548 TGCAGGTGGCCACCAGGAGCTGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924209493 1:241749808-241749830 TTCAGCTGGCTACCAAGAGCGGG - Intronic
1062969808 10:1638777-1638799 CACAGCTGGACCCGACGAGCTGG + Intronic
1067286182 10:44909056-44909078 GACAGCTGGCCACCCTGAGCAGG + Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1068566595 10:58582729-58582751 TGCAGGTGGCCTCCAAAAGCTGG - Intronic
1070305489 10:75236497-75236519 TCCATCTGGCCCCCAAAAGCAGG - Intergenic
1075550962 10:123391918-123391940 TACATCTGGCCACCACGTGCTGG - Intergenic
1077075951 11:702266-702288 TAGAGCTTGCCCCCCAGGGCGGG + Intronic
1077339999 11:2021998-2022020 CACAGCTTGCACCCAAGGGCTGG - Intergenic
1077543391 11:3158182-3158204 CACAGCTGTCCCCAAAGGGCAGG - Intronic
1078803253 11:14668945-14668967 TACAGAGGGTCCCCAGGAGCAGG - Intronic
1082079375 11:48000353-48000375 CACAGCTGGCCTCCAAGTCCTGG + Intronic
1082955828 11:58868732-58868754 TGCGGCTGGCCCCAAAGAGAGGG - Intronic
1084440037 11:69167564-69167586 ACCAGCTGGACTCCAAGAGCAGG + Intergenic
1084749447 11:71194509-71194531 AACAGCTGGATCCAAAGAGCAGG + Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1090963980 11:131582109-131582131 TAAAGCTGGCTCCCAGGGGCAGG - Intronic
1202822984 11_KI270721v1_random:77187-77209 CACAGCTTGCACCCAAGGGCTGG - Intergenic
1092346760 12:7721650-7721672 TACAGGTGGGCACCAAGGGCTGG - Intergenic
1092998305 12:13971890-13971912 TACAGCTTGCACCCAAGGGGTGG - Intronic
1095234333 12:39778365-39778387 TACAGCTGGCCCCCAAGAGCTGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1100205969 12:92350118-92350140 TACAGGTGGCCCCTAGAAGCTGG - Intergenic
1103479385 12:121241348-121241370 CACAGCTGGCCCTCAAGAAAGGG + Intronic
1104572594 12:129938215-129938237 TCCAGCTGGCTCACCAGAGCTGG + Intergenic
1112415604 13:99201084-99201106 TTCCGCTGACCCCCAAGACCGGG - Intronic
1112757235 13:102650611-102650633 CACAGCTGACGCCCAATAGCTGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1119081430 14:71697959-71697981 TACTGCTGTCCCCTAAGAGAAGG - Intronic
1119910459 14:78345153-78345175 AACAGCTGCCCCCCAAGTGTGGG - Intronic
1122050164 14:99053360-99053382 TACAGCTGGTATTCAAGAGCTGG - Intergenic
1122097414 14:99381813-99381835 TGCAGCTGGTCACCCAGAGCAGG - Intergenic
1122293838 14:100693999-100694021 CACAGCAGGCCCCCAAGAGAGGG + Intergenic
1123021970 14:105402966-105402988 TCCATCTGGACCCCAAGAGAGGG + Intronic
1123997241 15:25727399-25727421 TACAGGGGGCCCCCGAGAGTGGG + Intronic
1124400252 15:29341701-29341723 TATAGAAGGCCCCCAAGACCCGG - Intronic
1124982246 15:34577048-34577070 TACAGCTGGCTCACACGTGCAGG + Intronic
1129866544 15:78913415-78913437 CACAGGTGGCCACCAAGAGCAGG + Intergenic
1130547773 15:84869150-84869172 TGCAGCTGGGCCCCAAGACAGGG - Exonic
1132364276 15:101245237-101245259 TACACCTAGCCCCAAAGAGCTGG + Intronic
1133287681 16:4698164-4698186 TGCAGCTGGCCCTCATGGGCTGG + Intronic
1135590313 16:23700599-23700621 TCCGGCTGGCCCCCGAGTGCAGG + Exonic
1136635474 16:31519535-31519557 TACAGGTGCCCACCAAGACCTGG - Intergenic
1138197733 16:55064892-55064914 TAATGCTGGCCGACAAGAGCTGG - Intergenic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1141344638 16:83233585-83233607 TGCAGGTGGCCCCCAAAAGTTGG - Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1142196677 16:88742297-88742319 CACAGCTGGGTCCCAGGAGCTGG + Exonic
1142255245 16:89010764-89010786 CACAGCTGGCTGCCCAGAGCCGG - Intergenic
1142803661 17:2360475-2360497 TACAGCTAGCCTCTAAGAGCTGG - Intronic
1145780769 17:27561519-27561541 GACTGCTGGCCCCAAGGAGCGGG + Intronic
1146534027 17:33634073-33634095 TGCAACAGGCCCCCAAGAGTTGG + Intronic
1151898864 17:76998516-76998538 TGCAGCTGGCTCCCCAAAGCTGG - Intergenic
1160297939 18:77654928-77654950 TCCAGGTGGCCTCCAGGAGCTGG + Intergenic
1160313846 18:77822022-77822044 TGCAGCTGGGCCCCCAGACCAGG + Intergenic
1161068764 19:2250386-2250408 AGGAGCTGGCCCCCCAGAGCTGG + Exonic
1164436678 19:28236492-28236514 CACAGCTGGGCCCCTGGAGCTGG - Intergenic
1165523211 19:36330546-36330568 TTTAGCTGGCCGCCAAGAGATGG + Intergenic
1167146108 19:47681410-47681432 CACAGGTGGCCCCTAAGAGGAGG + Intronic
1168081246 19:54012096-54012118 AGCAGCCGGCCCCCAACAGCAGG - Exonic
925054062 2:842434-842456 CACAGCTGGACCCCAAAAGTGGG - Intergenic
925288578 2:2731357-2731379 TCCAGCTGGCTCCCAAGGCCTGG - Intergenic
927152885 2:20205804-20205826 GGCTGATGGCCCCCAAGAGCTGG - Intronic
928698875 2:33878703-33878725 TAAAGATGGCCCTAAAGAGCAGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929441157 2:41966753-41966775 CACAGCTGGAGCCCCAGAGCTGG + Intergenic
932627258 2:73307779-73307801 TGCTGCTGGCGCCCAACAGCTGG - Intergenic
933384262 2:81589852-81589874 TACAGCTCTCCTCCTAGAGCAGG - Intergenic
935791302 2:106592579-106592601 AACAACTGGCTCCCACGAGCTGG - Intergenic
938955930 2:136298226-136298248 TACAGTTGACCCCCAAGAGCAGG + Intergenic
939825633 2:147012083-147012105 TGCAGGTGGCCTCCAAAAGCAGG + Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
946084069 2:217153446-217153468 TGCAGCTGACCCCCAAGAATGGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947795492 2:232891427-232891449 TAGAGCTCGACCCCAAGTGCAGG - Exonic
948329436 2:237153399-237153421 CACAGGTGGCCCCCAGAAGCTGG - Intergenic
948593627 2:239066168-239066190 TACAGCTGGCCTCTGAGACCTGG - Intronic
1170923162 20:20698112-20698134 TACAGGTGGCTGTCAAGAGCTGG + Intronic
1174270969 20:49368113-49368135 TACAGATGGCCCTCAAAATCAGG - Exonic
1175278054 20:57785266-57785288 AACAGTTGGCTCCCAAGATCTGG + Intergenic
1175918359 20:62438124-62438146 TACAGCTGGCGCCGGGGAGCTGG + Intergenic
1176221991 20:63974111-63974133 TAAAGCTGGTTCCCAAGTGCTGG - Exonic
1178696319 21:34795709-34795731 CACAGATGGCCCCAAAGAGCGGG - Intronic
1183721739 22:39566809-39566831 TTAGGCTGGCCTCCAAGAGCAGG - Intergenic
1184039040 22:41932700-41932722 CACACCTGGCCCCCAAGAGGTGG - Intergenic
1184860939 22:47173079-47173101 TGCAGCAGGGCCCCGAGAGCTGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
967043729 3:185717645-185717667 AACAGCAGGCCCACAGGAGCTGG + Exonic
967919228 3:194602193-194602215 CACAGCTGGCCCCTGAGGGCTGG - Intronic
968228121 3:196988699-196988721 GCCAGTTGGCCCCCAGGAGCAGG - Intronic
975302866 4:72811764-72811786 TGCAGCTGGCCTCCAGAAGCTGG + Intergenic
979979095 4:127232467-127232489 TGCAGCAGGCTCCTAAGAGCAGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
985489532 5:171309-171331 CACAGCTGGCCTCCTTGAGCAGG - Exonic
985510171 5:309075-309097 TGTACCAGGCCCCCAAGAGCTGG + Intronic
986267210 5:6201075-6201097 TACAGTTGGCCACCGAGAGGAGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987396569 5:17430293-17430315 TGCAGCTCGAACCCAAGAGCTGG + Intergenic
989108987 5:37889119-37889141 TGCAGGTGGCCTCTAAGAGCTGG + Intergenic
991619429 5:68530243-68530265 TACAGCTGGCACTCAATAGATGG - Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
994140244 5:96333610-96333632 CACAGCTGACCTCCAACAGCAGG - Intergenic
1002213528 5:177612105-177612127 TACAGCAGGTGCCCATGAGCAGG + Intergenic
1004108603 6:12691027-12691049 GACTGCTGGCCCCAAATAGCTGG + Intergenic
1005615936 6:27573239-27573261 TACAGGTGGCCGCTAAGAGCTGG + Intergenic
1008017073 6:46532467-46532489 TGCAGCTGGCCTACAAGAACAGG + Intergenic
1008690540 6:53973771-53973793 TACAGATGGCCCCCAACATTTGG + Intronic
1009055247 6:58327194-58327216 TACAGTTGCTCCCCAAGATCAGG + Intergenic
1009235916 6:61123380-61123402 TACAGTTGCTCCCCAAGATCAGG - Intergenic
1017707074 6:157133108-157133130 TGCATCTGGCCCCCAGGAGAAGG - Exonic
1018852311 6:167649516-167649538 TGCAGCTTGCACCCAAGACCAGG - Intergenic
1019102514 6:169642654-169642676 TCTAGCAGGCCCCCAAGGGCAGG - Intronic
1019665085 7:2247854-2247876 AACAGCCGGCCGCCAAGAGGCGG + Intronic
1027055459 7:75046516-75046538 TAGGGCTGGCTCCCAGGAGCCGG - Intronic
1028131125 7:87175103-87175125 TATAGCTGGAGCCCAAGAGACGG - Intronic
1028233196 7:88330085-88330107 TACTGCTTGCTCCCTAGAGCAGG - Intergenic
1032613581 7:133442440-133442462 TTCAGAGAGCCCCCAAGAGCGGG + Intronic
1032781809 7:135170200-135170222 TACTTCTGGGCCCCAAGAGCAGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1042868522 8:73377122-73377144 TGCAGCTGGGCCCACAGAGCAGG + Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1047198402 8:122742661-122742683 GACAGCTGCCCCCTAAGAGAAGG + Intergenic
1048007041 8:130427839-130427861 TACAGCTGAGCCCCAACAGAGGG + Intronic
1050332373 9:4558266-4558288 CAGAGCTGGCCCCCAAGTCCAGG - Intronic
1056437732 9:86589579-86589601 TTCAGTTGGCCCTGAAGAGCTGG - Intergenic
1057706591 9:97399317-97399339 TACGGCTGGCCACCAGGAGGCGG - Intergenic
1060282030 9:122221325-122221347 AACATCTGTCCCCCAACAGCTGG + Intronic
1060514308 9:124256534-124256556 AGCAGCTGGCCCACAGGAGCGGG - Intergenic
1062204482 9:135328604-135328626 TCCAGCTGGCCCCCAACTGTGGG - Intergenic
1186329863 X:8520277-8520299 TACAGCTGTCTCCAAAGTGCAGG - Intergenic
1190982849 X:55472014-55472036 TACAGGTGGCCCCCAATATAGGG + Intergenic
1190985850 X:55501169-55501191 TACAGGTGGCCCCCAATATAGGG - Intergenic
1197774305 X:130110010-130110032 GACAGCGGGCCCCCAGAAGCTGG - Intronic
1198623631 X:138543103-138543125 TACAGGTGGCCTCCAGAAGCTGG - Intergenic
1200002360 X:153068636-153068658 TTCAGCTGGCCCCAAAGCACAGG - Intergenic
1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG + Intergenic