ID: 1095234620

View in Genome Browser
Species Human (GRCh38)
Location 12:39781878-39781900
Sequence CTGTACTTGCAGAGGTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095234611_1095234620 16 Left 1095234611 12:39781839-39781861 CCCTCACATACCCTGGAGGAAGG 0: 2
1: 0
2: 7
3: 35
4: 664
Right 1095234620 12:39781878-39781900 CTGTACTTGCAGAGGTGTCTAGG 0: 1
1: 0
2: 0
3: 16
4: 153
1095234617_1095234620 5 Left 1095234617 12:39781850-39781872 CCTGGAGGAAGGGATTTAGGACA 0: 1
1: 0
2: 1
3: 27
4: 235
Right 1095234620 12:39781878-39781900 CTGTACTTGCAGAGGTGTCTAGG 0: 1
1: 0
2: 0
3: 16
4: 153
1095234616_1095234620 6 Left 1095234616 12:39781849-39781871 CCCTGGAGGAAGGGATTTAGGAC 0: 1
1: 0
2: 3
3: 18
4: 206
Right 1095234620 12:39781878-39781900 CTGTACTTGCAGAGGTGTCTAGG 0: 1
1: 0
2: 0
3: 16
4: 153
1095234613_1095234620 15 Left 1095234613 12:39781840-39781862 CCTCACATACCCTGGAGGAAGGG 0: 1
1: 0
2: 2
3: 20
4: 226
Right 1095234620 12:39781878-39781900 CTGTACTTGCAGAGGTGTCTAGG 0: 1
1: 0
2: 0
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095234620 Original CRISPR CTGTACTTGCAGAGGTGTCT AGG Intronic
900125707 1:1068188-1068210 CTGCAGTTGGAGAGGTGTGTGGG - Intergenic
904565736 1:31427224-31427246 CACTACTTCCAGAGGTGTCTAGG - Intronic
905857282 1:41322370-41322392 CTGTTCTTCCAGAGGGGCCTGGG + Intergenic
906614092 1:47223346-47223368 CTGAACTTGCAGGGGTGGTTTGG - Intronic
907456311 1:54578366-54578388 CTGCACTGCCATAGGTGTCTTGG - Intronic
907848318 1:58229661-58229683 ACGTACTTGCAGAGGGGTCATGG + Intronic
907923222 1:58932108-58932130 CTGGAGATGCAGAGGTGACTTGG - Intergenic
909396321 1:75174554-75174576 CAGAACTTGCAGACCTGTCTTGG - Intergenic
909746875 1:79108408-79108430 CTCTACTTGAAGAGATGTATTGG + Intergenic
909948178 1:81687843-81687865 CAGTTCTTGCAGTGGTGGCTTGG + Intronic
911789782 1:101998783-101998805 ATGAATTTGCAGAGGTGTGTTGG + Intergenic
913368771 1:118072818-118072840 CTGTACATGCACATGTGTGTTGG + Intronic
917980876 1:180268205-180268227 CTAGACTTCCAAAGGTGTCTTGG - Intronic
918489490 1:185065668-185065690 TTGTTCCTTCAGAGGTGTCTAGG - Intronic
920694824 1:208174340-208174362 CTATTCTTGCAGAGGCGCCTGGG + Intronic
922473104 1:225888716-225888738 CTGGCCTTGCAGAGGTCTGTGGG - Intronic
1064678244 10:17783203-17783225 GTGTTCTTGCTGAGGAGTCTGGG - Intronic
1065046456 10:21751045-21751067 CTCTACTTGGAGAGGAGTTTGGG + Intergenic
1065403378 10:25332572-25332594 CTGTATTTGCAGAGGCATTTGGG + Intronic
1066463461 10:35633013-35633035 CTGTCATTGCAGAGATTTCTGGG + Intergenic
1067249469 10:44574881-44574903 CTGCACGTGCAGAGGCCTCTTGG - Intergenic
1068096480 10:52498498-52498520 CAGTACTTACAGTGGTGGCTTGG + Intergenic
1068263500 10:54616537-54616559 CTGTATCTGGAAAGGTGTCTGGG - Intronic
1070143152 10:73754020-73754042 CTATACTGGAAGAAGTGTCTTGG - Intronic
1072266268 10:93730860-93730882 CTGGACATCCAGAGTTGTCTTGG - Intergenic
1072737701 10:97889965-97889987 CTGTCCTTCCAGAGGGGACTGGG + Intronic
1074462286 10:113648856-113648878 CTGTACCTACAGACATGTCTAGG + Intronic
1075675794 10:124294961-124294983 CTGTACTTGCAGAGGCATGATGG - Intergenic
1075844576 10:125535126-125535148 CTGTTCCTGCAGAGCTGTGTTGG - Intergenic
1078169568 11:8919240-8919262 CTGTCCTTGCAGAGGTGTGATGG - Intronic
1081693836 11:45095602-45095624 ATGTAATTGCAGAGGAGTCTGGG - Intergenic
1081904315 11:46657600-46657622 CTGTAATTGCAGGGGTGCATGGG - Exonic
1085528816 11:77179723-77179745 CTGTCCTTGCAGATGCGTCTGGG + Exonic
1086011204 11:82105550-82105572 CTGTACTTGCAGTAGTGAGTGGG - Intergenic
1088763112 11:112950571-112950593 CAGTTCTTGCAGAGGTATCAAGG + Intergenic
1089712941 11:120329983-120330005 ATGAACTTGGAGAGGTGTATTGG - Exonic
1095234620 12:39781878-39781900 CTGTACTTGCAGAGGTGTCTAGG + Intronic
1097504011 12:60441398-60441420 CAGTTCTTGTAGTGGTGTCTTGG - Intergenic
1099238160 12:80107065-80107087 CTGGGCTTGCTCAGGTGTCTAGG + Intergenic
1101773691 12:107775085-107775107 CTGTCTTTGCAGAAGTTTCTGGG - Exonic
1103606314 12:122088325-122088347 CTGGGCTTGGAGAGGTCTCTAGG - Intronic
1105605636 13:21924364-21924386 CTGGGCTTACAGACGTGTCTGGG + Intergenic
1111165584 13:84454018-84454040 CAGTTCTTGCAGTGGTGGCTTGG + Intergenic
1111688710 13:91533616-91533638 CAGAACTTACAGAGGAGTCTGGG + Intronic
1114060648 14:19013612-19013634 CAGACCTTGCAGAGGTGGCTGGG + Intergenic
1114101607 14:19386366-19386388 CAGACCTTGCAGAGGTGGCTGGG - Intergenic
1114386893 14:22264871-22264893 CTGTACTTGCAGCAATGACTAGG - Intergenic
1115299435 14:31867118-31867140 CAGTTCTTGTAGAGGTGGCTTGG - Intergenic
1117896931 14:60496803-60496825 CAGTAGTTGCAGAGCTGACTCGG - Intronic
1118136075 14:63029489-63029511 TTGTATATGCAGAGGTATCTTGG + Intronic
1119717816 14:76871162-76871184 CTGCATGTGCAGAGGGGTCTTGG - Intergenic
1121633362 14:95437421-95437443 CTGGGCCTGCAGATGTGTCTTGG + Intronic
1123586425 15:21764561-21764583 CTGAGGTTGCAGAGGTGACTGGG + Intergenic
1123623064 15:22207141-22207163 CTGAGGTTGCAGAGGTGACTGGG + Intergenic
1124009305 15:25823942-25823964 CTGTAGTTGCAGAGGTGCATAGG - Intronic
1127464225 15:59228158-59228180 CTGTAGTTGAAAAGGTATCTAGG + Intronic
1129456319 15:75677705-75677727 TTGTTCTTCCAGAGGTGGCTGGG + Exonic
1130901873 15:88213318-88213340 CTCTACTTTTAAAGGTGTCTGGG + Intronic
1131563263 15:93462644-93462666 CTGTGAGTGCAGAGGTGTGTTGG - Intergenic
1132026044 15:98405293-98405315 CTGGCCTTGAAGGGGTGTCTAGG - Intergenic
1138412342 16:56850509-56850531 CTGTACTTACAGAGACCTCTGGG - Intergenic
1139080393 16:63511482-63511504 CTGCATTTGCAGAGGGTTCTAGG + Intergenic
1139601517 16:67990291-67990313 CTGGTCTGGCATAGGTGTCTTGG + Intronic
1140653505 16:77115036-77115058 CTGTAGCTGCAGAGGGGTCTGGG - Intergenic
1141250297 16:82350224-82350246 CTGTACTTGGAGCAGTGTTTTGG - Intergenic
1141304933 16:82853718-82853740 CTGTGCTTTCAAAGGTGTCTTGG + Intronic
1142524599 17:531159-531181 CTGTACTTGCCCTGATGTCTGGG - Intronic
1144479053 17:15613838-15613860 ATGTACTTGGAGAGGTGGATGGG + Exonic
1144919251 17:18749895-18749917 ATGTACTTGGAGAGGTGGATGGG - Exonic
1146002389 17:29139191-29139213 CTGCAGTTGCAGAAGGGTCTTGG + Intronic
1147419970 17:40317634-40317656 CTGGAGCTGCAGAGGTGTTTGGG + Intronic
1148342967 17:46884380-46884402 CTGAACTTGGAGAGGGGGCTGGG - Intronic
1148694931 17:49553020-49553042 CTGTCCTTTAGGAGGTGTCTGGG - Intergenic
1149507061 17:57203268-57203290 CTGTACTTACAGAGGAGGCCTGG + Intergenic
1151361757 17:73593269-73593291 CTTGAATTACAGAGGTGTCTGGG - Intronic
1151869008 17:76823983-76824005 CTCCACTTCCAGACGTGTCTCGG - Intergenic
1157840630 18:50955116-50955138 CTGCTCTTGCTGAGGTATCTAGG - Intergenic
1158300243 18:56043962-56043984 CTGTGCTTTGAGGGGTGTCTTGG + Intergenic
1161423090 19:4186484-4186506 CTGAAGTTGCAGGGGTGTATCGG - Intronic
1163092691 19:15031932-15031954 CTGTAGTTGCAAAGGAGCCTGGG + Intergenic
1163807975 19:19411499-19411521 TGGTACTTGCAGTGGTGTCTGGG + Intronic
1166196150 19:41207149-41207171 CTGCAGTTGCAGAGGTGGCTGGG - Exonic
1168339703 19:55615903-55615925 CGGCACTGGCAGGGGTGTCTGGG + Exonic
926854195 2:17234538-17234560 CTGTACTTCTAGAAGTATCTTGG + Intergenic
927948092 2:27149367-27149389 CTGCACCTGCAGAGGGGTCCAGG + Intronic
928984733 2:37170135-37170157 CTTTCCTTGCAGTGGTGGCTGGG - Intronic
931070320 2:58640258-58640280 CTGTGCTTGCTGAGCAGTCTGGG + Intergenic
932879872 2:75491386-75491408 CTGCAGTAGCAGAGGTGTTTGGG - Intronic
935538358 2:104321095-104321117 CTGTACTTGCAGTTGTTTTTGGG + Intergenic
935553289 2:104480699-104480721 CTGTGCATGCAGAGCTGTCTTGG + Intergenic
937331864 2:121036158-121036180 CTGTATTTGCAGAGCTGCCAGGG + Intergenic
939449383 2:142353319-142353341 CAGTTCTTGCAGTGCTGTCTTGG - Intergenic
942401736 2:175610101-175610123 CTCTACTTGCCGAGGTTTCTGGG + Intergenic
1168922333 20:1550596-1550618 CTGTACCTGCAGAGGATTCTGGG - Intronic
1168953681 20:1819635-1819657 CTGGACTTGGAGATGGGTCTCGG - Intergenic
1170814806 20:19704748-19704770 CAGTACTTGCAAAGGCGTCGAGG + Intronic
1171356459 20:24549570-24549592 CTGGCCTTGCAGTAGTGTCTAGG + Intronic
1177654713 21:24002945-24002967 CTGGATTTGCAGAGGAGACTGGG - Intergenic
1179719266 21:43306202-43306224 CTGGCCTTGCAGTGGTGACTGGG - Intergenic
1180479131 22:15736224-15736246 CAGACCTTGCAGAGGTGGCTGGG + Intergenic
1182118561 22:27772573-27772595 CTGCACCTGCAGGGTTGTCTTGG - Intronic
1182576302 22:31275375-31275397 CTGTGCTTGCAGAGGGCTCAGGG - Intronic
1183538947 22:38418637-38418659 CTGTAGTTGCTGGGCTGTCTTGG + Intergenic
1184031832 22:41899784-41899806 CAGTGCCTGCAGGGGTGTCTTGG - Intronic
950233578 3:11297829-11297851 TTGTACTTGCAGAGTTCTCCAGG + Intronic
959649247 3:108735844-108735866 CTGTCCCTGCAGAGGTGTCCAGG + Intergenic
959756799 3:109909340-109909362 CAGTTCTTGCAGTGGTGGCTTGG + Intergenic
960408461 3:117291714-117291736 CTGTCTTTGCAGAGATCTCTTGG + Intergenic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
965829373 3:172767059-172767081 CTGTAATGGCAGAGGCTTCTGGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968548474 4:1210522-1210544 CAGTGCTCGCAGAGGTCTCTTGG - Intergenic
970387941 4:15575240-15575262 CTGAATATGCATAGGTGTCTTGG + Intronic
971404814 4:26312618-26312640 CAGTCCTTGCAGAGATGACTTGG - Intronic
971607834 4:28681384-28681406 TTGTACTTGCAGAGGTGAAAAGG - Intergenic
972304014 4:37814311-37814333 CTTGACTTGCAGAAGTATCTGGG + Intergenic
972420038 4:38878395-38878417 CTGTTCTTGCAGGGGTATTTCGG - Exonic
975517427 4:75261809-75261831 CAGTTCTTGCAGTGGTGGCTTGG - Intergenic
982116823 4:152105042-152105064 AAGTAATTGCAGAGGTCTCTTGG + Intergenic
983682360 4:170368476-170368498 CTGGACCTGCAGAGGTTTTTAGG - Intergenic
988917186 5:35906341-35906363 CTGAAGCTGCAGAGGAGTCTGGG - Intronic
989795167 5:45460473-45460495 CTGTATTTCCAGTGGTGTCTTGG - Intronic
992050609 5:72937119-72937141 CTGTAGTTGCCGAGGTGTGTAGG - Intergenic
992753259 5:79880544-79880566 CTGTAGTTGCAAAGGAATCTGGG - Intergenic
993730218 5:91413315-91413337 CTGTACTTCAAGAAATGTCTTGG - Intergenic
993993924 5:94696658-94696680 CTTCACTTGTAAAGGTGTCTGGG + Exonic
996325582 5:122268983-122269005 CAGTTCTTGCAGTGGTGGCTTGG - Intergenic
998434050 5:142092016-142092038 CTTTCCTTGTAGAGGTGTATAGG + Intergenic
999250173 5:150177862-150177884 CTGTGACTCCAGAGGTGTCTCGG - Intronic
1001592995 5:172879125-172879147 CTGTTCTTGCAGACGAATCTCGG - Intronic
1003162387 6:3647124-3647146 CTGTCCTTACAGAGGAGTCCAGG + Intergenic
1003862460 6:10334950-10334972 TACTACTTGGAGAGGTGTCTGGG - Intergenic
1005677718 6:28172871-28172893 CTGTGCATGCTGAGGTGTCCTGG + Intergenic
1005852655 6:29833352-29833374 CTGTAGCTGCAGAGGCATCTGGG - Intergenic
1005876244 6:30011869-30011891 CTGTAGCTGCAGAGGCATCTGGG - Intergenic
1009700698 6:67175223-67175245 AACTACTTGCAGAGGTGACTCGG - Intergenic
1010462268 6:76126860-76126882 CTGCACTTGAAGAGGTCACTTGG + Intergenic
1010547822 6:77180354-77180376 CTGTTCATGCAGCCGTGTCTTGG - Intergenic
1019698422 7:2460628-2460650 CTGAATTCGCAGTGGTGTCTGGG + Intergenic
1023071633 7:36440527-36440549 TTGTGCTTGCAGAGGTATGTAGG + Intronic
1023599536 7:41867715-41867737 TTGTACTTTCAGAAGTGTCCAGG - Intergenic
1026896701 7:74013643-74013665 CTGTAGTGGCAGAGGTGATTGGG - Intergenic
1030956983 7:115865115-115865137 ATGTAGTTGCACAGGTCTCTGGG + Intergenic
1031341133 7:120603478-120603500 CTGTATATGCAGTGGGGTCTGGG + Intronic
1033719894 7:144048338-144048360 CTGGCCTTGAAGAGGTGTCATGG - Intergenic
1035703511 8:1655867-1655889 CTGTGCTGGCAGCGCTGTCTAGG - Intronic
1035878272 8:3215457-3215479 CTTTCCTGGCAGAGGTGTCCTGG - Intronic
1037713429 8:21375040-21375062 CAGTTCTTGCAGTGGTGGCTGGG + Intergenic
1042373918 8:68026148-68026170 CTATGCTTTCTGAGGTGTCTGGG + Intronic
1043729399 8:83655837-83655859 ATGTACTGGCAGAGGGGTGTTGG + Intergenic
1047080401 8:121453486-121453508 CCGTCCTTCCAGAGGTGACTAGG + Intergenic
1047749671 8:127870773-127870795 CCTTACTTGCAAAGTTGTCTGGG + Intergenic
1050419436 9:5448064-5448086 CTGTACTTGCAAAGAACTCTTGG + Intergenic
1052551730 9:29959313-29959335 CTGTACATGCAGAGTTGGGTGGG - Intergenic
1053157173 9:35789649-35789671 TTGTACTTGCGTAGGAGTCTGGG + Intergenic
1054938978 9:70719330-70719352 CTGTTCTTGCAGTGCTGGCTTGG - Intronic
1054940669 9:70737323-70737345 CTGTTCTTGCAGTGCTGGCTTGG - Intronic
1055150874 9:72997742-72997764 CTGTTCTTCCAAAGATGTCTGGG - Intronic
1055553110 9:77449565-77449587 CTGTCCTTCCACAGTTGTCTTGG - Intronic
1056293123 9:85164016-85164038 ATGTTCTTGCAGAGGCTTCTTGG + Intergenic
1056709257 9:88977421-88977443 CCGTACTGGCAGAGCTGGCTGGG + Intergenic
1056737524 9:89222779-89222801 CCTCACTTGCAGAGGTCTCTGGG - Intergenic
1058156551 9:101522898-101522920 CAGTTCTTGCAGTGGTGGCTTGG + Intronic
1186640323 X:11448803-11448825 ATGTACATGCAGGGGTGTCCAGG - Intronic
1188045712 X:25424530-25424552 CAGTACTTGTAGTGGTGGCTTGG + Intergenic
1197664559 X:129210129-129210151 CTGTTCTGGTAGAGGTGTCAGGG + Intergenic
1197668905 X:129254396-129254418 CAGTTCTTGCAGTGGTGTCTTGG + Intergenic
1199668723 X:150122756-150122778 CAGTTCTTGCAGTGGTGGCTTGG - Intergenic
1200398517 X:156005499-156005521 CTGCACTTCCAGCGGAGTCTGGG + Intronic
1201935502 Y:19407031-19407053 CTGAGATTGCAGAGATGTCTGGG + Intergenic