ID: 1095239418

View in Genome Browser
Species Human (GRCh38)
Location 12:39839190-39839212
Sequence GTCGCTGTCCCGACTGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095239418_1095239420 -7 Left 1095239418 12:39839190-39839212 CCACTACCAGTCGGGACAGCGAC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1095239420 12:39839206-39839228 CAGCGACTCCATGCCTTGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 123
1095239418_1095239423 6 Left 1095239418 12:39839190-39839212 CCACTACCAGTCGGGACAGCGAC 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1095239423 12:39839219-39839241 CCTTGCTTGGAGCCTCGTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095239418 Original CRISPR GTCGCTGTCCCGACTGGTAG TGG (reversed) Intronic
907533837 1:55129247-55129269 GTCTCTTTCCCCTCTGGTAGTGG - Intronic
923107661 1:230867408-230867430 GACACTGTCCAGACTGCTAGAGG - Intronic
1068668247 10:59698363-59698385 GACTCTGTCCCCACTGGTGGTGG + Intronic
1073071755 10:100798765-100798787 GGTGCTGTCCAGACTGGGAGAGG - Intronic
1082140473 11:48603147-48603169 TTCCCTGTCCACACTGGTAGCGG - Intergenic
1083902405 11:65650035-65650057 GTCGCTGTCCCGAGAGGGTGAGG + Exonic
1095239418 12:39839190-39839212 GTCGCTGTCCCGACTGGTAGTGG - Intronic
1122830432 14:104393133-104393155 GTCGCTGCACCCACTGGCAGTGG + Intergenic
1127480310 15:59371977-59371999 GCAGCTGTCCCGCCTGGCAGCGG - Intronic
1127535470 15:59886008-59886030 TGAGCTGTCCGGACTGGTAGCGG - Intergenic
1128709598 15:69861731-69861753 ATGGTTGTCACGACTGGTAGGGG - Intergenic
1130026724 15:80276823-80276845 GTAGCTGTCCCTTCTGGTCGGGG + Intergenic
1130263265 15:82376197-82376219 GTCTCTGTCCGGGCTGGTGGTGG + Intergenic
1130278038 15:82493469-82493491 GTCACTGTCCGGGCTGGTGGTGG - Intergenic
1130470367 15:84220654-84220676 GTCACTGTCCGGGCTGGTGGTGG - Intergenic
1130477855 15:84335221-84335243 GTCACTGTCCGGGCTGGTGGTGG - Intergenic
1130493910 15:84452909-84452931 GTCACTGTCCGGGCTGGTGGTGG + Intergenic
1135601877 16:23790545-23790567 GTCCCTGTCCAGAGTTGTAGCGG - Intergenic
1157587160 18:48810199-48810221 GTGGCTATCCCGACTGATATGGG - Intronic
1166688065 19:44808051-44808073 GTCGCTGGCCACACTGGGAGAGG - Intergenic
934862902 2:97779371-97779393 GTCTCTGTCCCCACAGGGAGTGG + Intronic
947196219 2:227570537-227570559 GTGGCTGTCCCGAGTTCTAGTGG + Intergenic
947754395 2:232550982-232551004 GTGGCTGTGCCGCCCGGTAGGGG + Intronic
1175608915 20:60333976-60333998 GTGGCTGTGCCAAGTGGTAGCGG + Intergenic
1181631740 22:24155300-24155322 GTCGCTCTCCGGCCTGGAAGCGG - Intronic
1184024049 22:41840800-41840822 GTCACTGTCCCAACTTGTTGGGG + Intronic
967727180 3:192872736-192872758 TTTGCTGTCCTGACTGGGAGAGG - Intronic
1014049868 6:116939187-116939209 GTCGCTCTCCCGACTCGTTCTGG - Intergenic
1018494056 6:164329903-164329925 GTGGCTGTCCTGACTAATAGAGG + Intergenic
1022320415 7:29282956-29282978 GTGGATGGCCCGAGTGGTAGAGG + Intronic
1027194909 7:76023264-76023286 GTCTCTGTCCAGCCTGGTGGTGG - Intronic
1035812096 8:2501036-2501058 GCTGCTGCCCCGACTGGTAAAGG - Intergenic
1051338988 9:16093795-16093817 GTCTATGTGCCGACTGCTAGAGG - Intergenic
1056933192 9:90895688-90895710 CTGGCTCTCCCGACTGGCAGAGG - Exonic
1062444412 9:136587678-136587700 GTCGCTGCCCAGTGTGGTAGGGG + Intergenic
1186692504 X:11993443-11993465 GTGGCTGTCACAACTGGCAGGGG - Intergenic