ID: 1095240747

View in Genome Browser
Species Human (GRCh38)
Location 12:39856218-39856240
Sequence ATGCATGGATAGATGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3390
Summary {0: 1, 1: 21, 2: 326, 3: 888, 4: 2154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095240747 Original CRISPR ATGCATGGATAGATGGATGA AGG (reversed) Intronic
Too many off-targets to display for this crispr