ID: 1095245111

View in Genome Browser
Species Human (GRCh38)
Location 12:39910792-39910814
Sequence TCAGAAATGTAGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1725
Summary {0: 2, 1: 0, 2: 31, 3: 231, 4: 1461}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095245111 Original CRISPR TCAGAAATGTAGGCCAGGTG TGG Intronic
900235868 1:1590155-1590177 TAAGAAACGTAGGCCGGGCGTGG + Intergenic
900275716 1:1826124-1826146 ACTGACATTTAGGCCAGGTGTGG + Intronic
900286592 1:1903980-1904002 ACAAAAATGGGGGCCAGGTGCGG + Intergenic
900312421 1:2040386-2040408 TCTGAAATGGAGGCCAGGTGTGG + Intergenic
900970432 1:5989732-5989754 TCAGAAATCTGGGGCAGGTGAGG - Intronic
901153083 1:7117259-7117281 AAAGAAAGATAGGCCAGGTGTGG - Intronic
901247183 1:7741271-7741293 TTAGAAATGTTGGCCGGGCGCGG + Intronic
901320337 1:8336119-8336141 TCAGAATTTGAGGCCAGGCGCGG + Intronic
901382221 1:8882050-8882072 AAAGAAATGGAGGCCGGGTGCGG + Intergenic
901397932 1:8995156-8995178 TTAAAAATATTGGCCAGGTGTGG + Intergenic
901408256 1:9064759-9064781 TCAACAATGTAGGCCAGGCGCGG + Intronic
901466460 1:9424647-9424669 AAAGAACTGGAGGCCAGGTGTGG + Intergenic
901546294 1:9960369-9960391 TCAGTTATTTTGGCCAGGTGTGG + Intronic
901580746 1:10240852-10240874 TAAGAAATGAGGGCCAGGTGTGG - Intronic
901583457 1:10265552-10265574 ACACAAATTAAGGCCAGGTGCGG + Intronic
902234681 1:15049731-15049753 TCAGAACTATAGGCCAGGTGTGG + Intronic
902899991 1:19508240-19508262 TTTAAAAAGTAGGCCAGGTGCGG + Intergenic
903201274 1:21741684-21741706 TATGAAAAATAGGCCAGGTGTGG + Intronic
903435803 1:23348161-23348183 TTACATATCTAGGCCAGGTGCGG - Intergenic
903596581 1:24500105-24500127 CAAGAAATGGAGGCCGGGTGCGG + Intergenic
903903837 1:26669011-26669033 AGAAAACTGTAGGCCAGGTGCGG - Intergenic
903982143 1:27196845-27196867 ACAGCTATGTGGGCCAGGTGTGG - Intergenic
904166969 1:28563257-28563279 TAACAAAGGTAGGCCGGGTGCGG + Intronic
904412627 1:30333897-30333919 TGCAAAATGTAGGCCAGGTGTGG - Intergenic
904707360 1:32401375-32401397 TCAGGAATTTTGGCCGGGTGTGG + Intergenic
904740316 1:32670064-32670086 TAAGAAAACTAGGCCAGGTATGG + Intronic
904988779 1:34574357-34574379 TGAAAAATGTAGGCCTGGCGTGG - Intergenic
905057850 1:35112466-35112488 TAAAAAATCTGGGCCAGGTGTGG - Intronic
905131414 1:35761784-35761806 TCAGAACTGTAGTGCAGGTAAGG - Intronic
905200086 1:36309474-36309496 TCCAAAATGCAGGCCAGGCGTGG - Intronic
905211256 1:36375728-36375750 TCATAACTTTAGGCCAGGCGCGG + Intronic
905418109 1:37818702-37818724 TCAAAAAAAAAGGCCAGGTGTGG + Intronic
905462261 1:38129584-38129606 TCAGAGATTCAGGCCAGGAGCGG - Intergenic
905496866 1:38396850-38396872 TCAGAAATGAAGGCGAGATAAGG + Intergenic
905567943 1:38980691-38980713 TAAAAAATTAAGGCCAGGTGTGG - Intergenic
905583583 1:39100561-39100583 TCAAAAATTTAGGCCGGGTGCGG + Intronic
905593653 1:39186898-39186920 ACAGAAATGTGGCCCAGGTGTGG - Intronic
905652328 1:39664777-39664799 CAAGAAAAGCAGGCCAGGTGCGG - Intronic
905930935 1:41787040-41787062 TTACATATGTAGGCCGGGTGTGG - Intronic
906100992 1:43261508-43261530 TAAGAGCTGTAGGCCAGGTGTGG + Intronic
906193888 1:43916867-43916889 TAAGAATTTTGGGCCAGGTGCGG - Intronic
906373889 1:45278329-45278351 ACAGAAAAGCAGGCCAGGTATGG + Intronic
906396976 1:45474766-45474788 AAAGAGATGGAGGCCAGGTGTGG - Intronic
906437169 1:45805936-45805958 TTAGAAATGTATACAAGGTGAGG - Intronic
906620759 1:47276290-47276312 TAAATAATGTAGACCAGGTGCGG - Intronic
906765123 1:48423164-48423186 TCAGAAAAGTAGGCCGGGCATGG + Intronic
906928296 1:50142491-50142513 TCTGAGTTCTAGGCCAGGTGCGG - Intronic
907033890 1:51199262-51199284 TTAAAAGTGTTGGCCAGGTGCGG - Intergenic
907077156 1:51589377-51589399 TGAAAAATGTAGGCCAGGCGTGG - Intronic
907085426 1:51668329-51668351 TAAGAAAAGGGGGCCAGGTGTGG + Intronic
907154161 1:52317226-52317248 TTAGAAAAAAAGGCCAGGTGCGG + Intronic
907195067 1:52679859-52679881 AAAGAAATGTAGGCCAAGAGCGG + Intergenic
907298736 1:53471965-53471987 TCAGAAAAGTGGGCTGGGTGTGG - Intergenic
907540132 1:55208335-55208357 ACAATAATGTTGGCCAGGTGCGG + Intronic
908188088 1:61671814-61671836 TAAAAAATTTAGGCCAGGCGCGG + Intergenic
908196774 1:61752614-61752636 AAAGAAATGAAGGCCAGGCGCGG - Intronic
908203394 1:61820630-61820652 AAATAAATGTAGGCCGGGTGTGG - Intronic
908210261 1:61893508-61893530 TAAAGAATTTAGGCCAGGTGTGG + Intronic
908262687 1:62351166-62351188 TCAAAAATTTCCGCCAGGTGCGG + Intergenic
908362527 1:63382964-63382986 ACAAAAACTTAGGCCAGGTGCGG - Intronic
908519976 1:64932122-64932144 TAAGAAATCTGGGCCAGGTGTGG + Intronic
908776072 1:67641255-67641277 TTAAAAATCTAGGCCAGGTGCGG - Intergenic
908781714 1:67697078-67697100 TAACAGATGCAGGCCAGGTGCGG + Intergenic
909657965 1:78051783-78051805 TCACAATTCTACGCCAGGTGCGG - Intronic
909931936 1:81506416-81506438 CAAGAAATGTTGGCCAGGCGCGG + Intronic
910179175 1:84462716-84462738 AAAGAAATGTGGGCCAGGCGCGG - Intergenic
911319396 1:96394577-96394599 TGAAAAATTTAGGCCATGTGAGG + Intergenic
911638076 1:100258031-100258053 TCATGTATGTGGGCCAGGTGTGG - Intergenic
911760732 1:101612139-101612161 TCAGGAAAGAAGGCCAGGGGTGG + Intergenic
912145995 1:106795186-106795208 AAATAAATGTAGGCCGGGTGTGG + Intergenic
912188831 1:107314112-107314134 TAAAAAATGAAGGCCAGGTGTGG + Intronic
912343992 1:108946871-108946893 ATAGAAATTTTGGCCAGGTGCGG + Intronic
912351455 1:109018037-109018059 TGAAAAATTTAGGCCAGGTGAGG - Intronic
912363179 1:109111755-109111777 TGAGTTAGGTAGGCCAGGTGAGG - Intronic
912403628 1:109417931-109417953 AAAGAAATGTGGGCCAGGAGTGG + Intronic
912850241 1:113117769-113117791 TCAGAAATGCCAGCCAGGTGCGG - Intronic
912964910 1:114228910-114228932 TAAGAAATCCTGGCCAGGTGTGG - Intergenic
913247331 1:116881602-116881624 TTAGAAGTCTCGGCCAGGTGCGG - Intergenic
913298838 1:117349184-117349206 TAAGAAAAGCTGGCCAGGTGCGG + Intergenic
913298996 1:117350758-117350780 CCACAAAATTAGGCCAGGTGTGG - Intergenic
913572392 1:120133750-120133772 TCACAGATGGAGGCCAGATGAGG + Intergenic
913962508 1:143351281-143351303 AAAAAAATGCAGGCCAGGTGTGG + Intergenic
914056863 1:144176858-144176880 AAAAAAATGCAGGCCAGGTGTGG + Intergenic
914122283 1:144789504-144789526 AAAAAAATGCAGGCCAGGTGTGG - Intergenic
914259328 1:145985659-145985681 GCACAAATGTTGGCCAGGCGCGG + Intergenic
914261175 1:146000438-146000460 TAACAATTGTAAGCCAGGTGTGG + Intergenic
914891115 1:151624254-151624276 TTAGAATTTTAGGCCAGGTGAGG - Intronic
915177967 1:154032625-154032647 TGAGACATACAGGCCAGGTGTGG + Intronic
915198668 1:154209878-154209900 TAAAAAAATTAGGCCAGGTGTGG - Intronic
915397082 1:155593202-155593224 TAAGAACAGTAGGCCAGGTGCGG - Intergenic
915436255 1:155908851-155908873 TCAGAGATTCAGGCCAGGCGCGG - Intronic
915437568 1:155920147-155920169 TAAGAAATTGTGGCCAGGTGCGG + Intronic
915574096 1:156763876-156763898 ATAGAAATTTAGGCCAGGCGCGG - Intronic
915707945 1:157864232-157864254 TAAGAACTGTGGGCCTGGTGAGG - Intronic
916036602 1:160928044-160928066 ATAAAAATTTAGGCCAGGTGCGG + Intergenic
916559396 1:165920315-165920337 TCAGTAAAGAAGGCCAGGTATGG - Intergenic
916693435 1:167213283-167213305 TTAAAAATGTTGGCCAGGCGCGG + Intergenic
916695106 1:167227074-167227096 AAAGAAATCTGGGCCAGGTGTGG - Intronic
917113219 1:171573965-171573987 TGAGAAATAGAGGCCGGGTGCGG - Intronic
917740274 1:177955203-177955225 AGAGAAATGCAGGCCCGGTGCGG + Intronic
917757480 1:178116889-178116911 TTAGCAATCTAGGCCAGGTGTGG - Intronic
917857961 1:179117123-179117145 ACAGAAGTATAGGCCTGGTGTGG - Intronic
918213429 1:182371802-182371824 TAAGAAATGTAGGCTGGGCGTGG - Intergenic
918362678 1:183774862-183774884 TAACAAATGTAGGCCAGGCGTGG - Intronic
918493959 1:185113141-185113163 TAAGTAATAAAGGCCAGGTGTGG + Intergenic
918570303 1:185982729-185982751 TTAGGAATGTGGGCCAGGTGTGG - Intronic
918729609 1:187974553-187974575 TTAGAAAAGTAGGCCGGGTGCGG - Intergenic
918900341 1:190408332-190408354 TGACAAATGTAGGCCGGATGCGG - Intronic
919305157 1:195823098-195823120 TGAAAAATCTGGGCCAGGTGCGG + Intergenic
919426820 1:197442832-197442854 TGAGAATTACAGGCCAGGTGTGG + Intronic
919485848 1:198146273-198146295 TAAGATATATAGGCCGGGTGCGG - Intergenic
919523315 1:198616139-198616161 AAAGAAATGTAGGCCAGTTGTGG - Intergenic
919793418 1:201306958-201306980 AAAAAAATGTAGTCCAGGTGCGG - Intronic
920428575 1:205899059-205899081 ACACACATTTAGGCCAGGTGTGG - Intergenic
920547542 1:206830865-206830887 AAAGAAACGTAGGCCAGGAGCGG - Intronic
920754260 1:208713680-208713702 TAAGAAATGGTGGCCAGGTGTGG - Intergenic
920871989 1:209802726-209802748 TCAGAACTGTGGTCCAGGTAGGG - Intronic
921151652 1:212407782-212407804 CCACTGATGTAGGCCAGGTGCGG + Intronic
921195288 1:212750647-212750669 ACAGAAAAATAGGCCAGGTATGG + Intronic
921224306 1:213002625-213002647 TAAAAATTGTTGGCCAGGTGCGG + Intronic
921342990 1:214153310-214153332 TGAAAAATATAGGCCAGGCGTGG + Intergenic
921643268 1:217581660-217581682 TTAGAAGTTTAGGCCAGGTGCGG + Intronic
921895369 1:220394652-220394674 TTAGAACTTTAGGCAAGGTGAGG - Intergenic
922016262 1:221651110-221651132 TGTCAAATTTAGGCCAGGTGGGG + Intergenic
922292101 1:224216858-224216880 TCAGACATGAAGGCCAGGCGCGG + Intergenic
922488630 1:225997719-225997741 CAAGAAATATAGGCCAGGCGTGG - Intronic
922510812 1:226165459-226165481 TAAGAAAAATAGGCCAGGTGCGG - Intronic
922521034 1:226252680-226252702 AAAGAAATCCAGGCCAGGTGTGG + Intronic
922754294 1:228086358-228086380 ACAAAAAAATAGGCCAGGTGTGG + Intronic
922943328 1:229488134-229488156 TTAACAATTTAGGCCAGGTGCGG - Intronic
922984631 1:229856694-229856716 TAAGAAATATAGGCCAGGTGTGG + Intergenic
923330806 1:232922753-232922775 CAAGAAAAGTAGGCCAGATGTGG - Intergenic
923552603 1:234976073-234976095 GCAGAAATGGAGGCCAGGAAAGG + Intergenic
923609396 1:235476557-235476579 TAAAAAATTTAGGCCAGGCGTGG + Intronic
923667962 1:236015354-236015376 TCAAATATGTAGGCCGGGCGTGG + Intronic
923742198 1:236665164-236665186 ACAAAAATCTAGGCCAGGTATGG - Intergenic
923902831 1:238347692-238347714 TTTGAAAACTAGGCCAGGTGCGG + Intergenic
924055021 1:240116598-240116620 ACAGAAATGTTGGCTGGGTGTGG + Intronic
924117995 1:240766691-240766713 TTATAAAGGCAGGCCAGGTGTGG - Intergenic
924171196 1:241342970-241342992 TTAAAAGTATAGGCCAGGTGCGG + Intronic
924184988 1:241478803-241478825 TAAAAAATATTGGCCAGGTGTGG + Intergenic
924244324 1:242067437-242067459 TTAAAAATCTTGGCCAGGTGTGG - Intergenic
924263828 1:242260056-242260078 AGAGAATTGTTGGCCAGGTGGGG + Intronic
924827913 1:247561242-247561264 TTTTAAAAGTAGGCCAGGTGTGG - Intronic
1062772581 10:114606-114628 TCAGAAAGGTAGGCTGGGCGTGG - Intergenic
1063212946 10:3897870-3897892 TCTGAAATGGAGGCTGGGTGCGG - Intergenic
1063809861 10:9692539-9692561 TTAGAAGTCTGGGCCAGGTGCGG - Intergenic
1063904675 10:10769470-10769492 TCAGCTCTGTAGGCCAGGCGTGG + Intergenic
1064188719 10:13186699-13186721 TAAGCAATTCAGGCCAGGTGTGG + Intronic
1064211977 10:13367253-13367275 TGTGAAAGGTGGGCCAGGTGTGG + Intergenic
1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG + Intergenic
1064558572 10:16572737-16572759 AAAGCAAAGTAGGCCAGGTGAGG + Intergenic
1065016385 10:21466561-21466583 TAAGAATTGTTGGCCAGGCGCGG + Intergenic
1065523868 10:26597835-26597857 ATAGAAGTGGAGGCCAGGTGCGG + Intergenic
1065579912 10:27160458-27160480 AGGTAAATGTAGGCCAGGTGTGG + Intronic
1065850282 10:29782068-29782090 ACAGAAATTAAGGCCGGGTGCGG + Intergenic
1065886533 10:30082559-30082581 TAAAAAAATTAGGCCAGGTGTGG + Intronic
1066088811 10:31997436-31997458 TCAAAAATTAGGGCCAGGTGTGG - Intergenic
1066181614 10:32967150-32967172 TATGAAGTCTAGGCCAGGTGTGG - Intronic
1066382594 10:34913850-34913872 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1066384727 10:34932487-34932509 CCAAACAGGTAGGCCAGGTGTGG - Intergenic
1066414985 10:35213557-35213579 AAAGAAATTTAGGCCGGGTGCGG - Intergenic
1066507678 10:36062484-36062506 TCAAAGATATAGGCCAGGCGCGG + Intergenic
1066720970 10:38338416-38338438 AGAGAATTGTTGGCCAGGTGGGG - Intergenic
1067017727 10:42770404-42770426 TCAGGAAGGAAGGCCAGGAGAGG - Intergenic
1067049773 10:43007924-43007946 AGAGAAATTTAAGCCAGGTGGGG - Intergenic
1067152272 10:43746591-43746613 TTACAAGTGTAGGCCAGGCGCGG + Intergenic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1068169861 10:53379356-53379378 TTAAAAATATAGGCCAGGCGTGG + Intergenic
1068211151 10:53922794-53922816 ACACAAATATAGGTCAGGTGTGG + Intronic
1068292484 10:55022160-55022182 TCAAAAATGTAGGCCGGGCTCGG + Intronic
1068422994 10:56820988-56821010 TGAAAAATCAAGGCCAGGTGCGG + Intergenic
1069000921 10:63263639-63263661 ATACAAATGAAGGCCAGGTGTGG + Intronic
1069253403 10:66300180-66300202 TCCTCATTGTAGGCCAGGTGTGG - Intronic
1069369897 10:67736738-67736760 TAAAAAATGTGGGCCGGGTGTGG - Intergenic
1069480559 10:68777928-68777950 TCTGAAAAGAAGGCCGGGTGCGG + Intronic
1069504507 10:68985943-68985965 AAAGAAATATTGGCCAGGTGTGG - Intergenic
1069659690 10:70115474-70115496 AAATAAATGCAGGCCAGGTGTGG + Intronic
1069672507 10:70220218-70220240 GCATAATTGCAGGCCAGGTGCGG - Intronic
1069977979 10:72231082-72231104 GCAGAAATGAAGGCCTGGTGAGG - Intronic
1070000402 10:72372076-72372098 AAATAAATGTAGGCCAGGTGTGG + Intronic
1070029354 10:72662114-72662136 AGAGCAGTGTAGGCCAGGTGCGG - Intergenic
1070104163 10:73415832-73415854 TCAGAGATGTTGACCAGGTATGG - Intergenic
1070104680 10:73420287-73420309 TTAAAATTTTAGGCCAGGTGTGG - Intergenic
1070171914 10:73939467-73939489 TTAAAAATGTTGGCCGGGTGTGG - Intergenic
1070206206 10:74265094-74265116 TAAGAAAATTTGGCCAGGTGTGG - Intronic
1070209262 10:74298613-74298635 TGAGGATTTTAGGCCAGGTGTGG + Intronic
1070234706 10:74611323-74611345 TCTACAATTTAGGCCAGGTGTGG - Intronic
1070238453 10:74654941-74654963 TCCGACATGTTGCCCAGGTGCGG - Intronic
1070610802 10:77931108-77931130 ACAAAAATTAAGGCCAGGTGTGG - Intergenic
1070795786 10:79215587-79215609 GCAGTGATTTAGGCCAGGTGTGG - Intronic
1071056179 10:81510487-81510509 TCAAAGAAATAGGCCAGGTGCGG - Intergenic
1071289107 10:84175794-84175816 TGTGCAAAGTAGGCCAGGTGTGG - Intronic
1071364811 10:84888596-84888618 TAAGAAATCTAGGCCGGGCGCGG + Intergenic
1071428840 10:85587230-85587252 TAAAAAATTTGGGCCAGGTGCGG - Intergenic
1071588749 10:86850789-86850811 GGAGAACTTTAGGCCAGGTGTGG - Intronic
1071849554 10:89554783-89554805 TAAGTAAAGTAGGCCAGCTGGGG - Intronic
1071890008 10:89994210-89994232 TAAGAAATTTAGGCTGGGTGTGG + Intergenic
1072232448 10:93425092-93425114 TCAAAAAAATTGGCCAGGTGTGG - Intronic
1072343416 10:94478416-94478438 CTGGAAATGTAGGCCAGGCGTGG + Intronic
1072393514 10:95014553-95014575 CAATAAACGTAGGCCAGGTGAGG - Intergenic
1072586137 10:96784043-96784065 TAATATATATAGGCCAGGTGCGG - Intergenic
1072597488 10:96887969-96887991 CGAAAAAAGTAGGCCAGGTGTGG - Intronic
1072688187 10:97551243-97551265 TCACAAATGTTGGCCAGGCATGG + Intronic
1072968688 10:99997654-99997676 TTAAAAAAGGAGGCCAGGTGCGG + Intronic
1073017901 10:100416408-100416430 TAACAAATAGAGGCCAGGTGTGG - Intergenic
1073319110 10:102603315-102603337 AGAGAAATACAGGCCAGGTGTGG - Intronic
1073357302 10:102867289-102867311 TAAGGATTGTTGGCCAGGTGTGG + Intronic
1073397962 10:103233768-103233790 TGGGCAATGTCGGCCAGGTGCGG + Intergenic
1073497511 10:103906966-103906988 TGTGAAATGTAAGCCAGGTGCGG + Intronic
1073545938 10:104348954-104348976 ACAAAAATTGAGGCCAGGTGTGG + Intergenic
1074024136 10:109616103-109616125 TAAGAAGTGTGGGCCAGGTGTGG - Intergenic
1075097548 10:119482508-119482530 TTATAAATTGAGGCCAGGTGCGG - Intergenic
1075744990 10:124720907-124720929 TCAGAAATCTGGGCCGGGTGCGG + Intronic
1075803804 10:125170727-125170749 ACAGAAATATTGGCCAGGTGTGG + Intergenic
1076083590 10:127605816-127605838 TAAGAATTGTGGGCCGGGTGCGG + Intergenic
1076099201 10:127760763-127760785 TCAGCAAGTAAGGCCAGGTGCGG - Intergenic
1076303804 10:129449168-129449190 AAAAAAAAGTAGGCCAGGTGTGG + Intergenic
1077301189 11:1847708-1847730 AAAAAAATGAAGGCCAGGTGTGG + Intergenic
1077615990 11:3674216-3674238 TCGGAATTGTGGGCCAGGAGTGG - Intronic
1078182638 11:9025585-9025607 TCAGAAAGGCAGGCAAGATGAGG - Intronic
1078789936 11:14532312-14532334 TAAAAAAGGGAGGCCAGGTGCGG + Intronic
1078827137 11:14940133-14940155 ACAGAAAATTGGGCCAGGTGTGG - Intronic
1078997488 11:16718839-16718861 CCACATATATAGGCCAGGTGTGG + Intronic
1079041715 11:17065574-17065596 TAAAAAAATTAGGCCAGGTGCGG - Intergenic
1079293942 11:19214909-19214931 TCATCACTTTAGGCCAGGTGTGG + Intergenic
1079374531 11:19880111-19880133 GCTGAAATGCAGTCCAGGTGGGG + Exonic
1079429037 11:20370937-20370959 TTAAAAATATAGGCCGGGTGCGG - Intronic
1079608598 11:22401984-22402006 TTAGAAATGCAGGCCGGGCGCGG + Intergenic
1080243774 11:30156667-30156689 TTAGAAATCTGGGCCAGGTGCGG - Intergenic
1080353500 11:31413484-31413506 ACAAAAATATTGGCCAGGTGTGG - Intronic
1080625092 11:34021773-34021795 TAAGATATGTAGGCTGGGTGTGG - Intergenic
1080651717 11:34228023-34228045 ACAAAAAAGTAGGCCAAGTGTGG - Intronic
1080651766 11:34228348-34228370 ACAAAAAAGTAGGCCAAGTGTGG - Intronic
1080665141 11:34329437-34329459 TGAGAACTGTAGGTCAGCTGTGG - Intronic
1080732102 11:34967140-34967162 ATAAAAATCTAGGCCAGGTGCGG - Intronic
1080812696 11:35721192-35721214 AAAGAATTATAGGCCAGGTGTGG - Intronic
1080852512 11:36082216-36082238 TTAAAAAAGTTGGCCAGGTGTGG + Intronic
1081225846 11:40521578-40521600 TAAGAAAAATAGGCCAGGCGCGG + Intronic
1081320372 11:41685084-41685106 TAAGAACTTTAGGCCAGGGGTGG + Intergenic
1081472086 11:43383874-43383896 ATAGACATGCAGGCCAGGTGTGG + Intronic
1081479841 11:43475613-43475635 TCTGAAATTGAGGCCAGGTGTGG - Intronic
1082027058 11:47580236-47580258 GCAGAAATGCAGGCAATGTGAGG + Intronic
1082083767 11:48032461-48032483 TAACAAATCTAGGCCGGGTGCGG + Intronic
1082231066 11:49767200-49767222 TTAGAACAGTGGGCCAGGTGTGG + Intergenic
1082841559 11:57694280-57694302 TAAGAAATATGGGCCAGGCGTGG - Intronic
1082888346 11:58111995-58112017 TTATAAATATGGGCCAGGTGTGG + Intronic
1083018840 11:59485304-59485326 GCAGAAATGGAGGCTGGGTGCGG - Intergenic
1083398544 11:62408062-62408084 ACAGAATTGGAGTCCAGGTGCGG - Intronic
1083423293 11:62568522-62568544 AAAGAAATGGAGGCCAGGTGTGG - Intronic
1083703532 11:64497147-64497169 ACAAAAAATTAGGCCAGGTGCGG - Intergenic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1084079069 11:66807279-66807301 TCATAAAAGCAGGCCGGGTGTGG + Intronic
1084132385 11:67146281-67146303 AAAGAAATGGGGGCCAGGTGCGG - Intronic
1084207128 11:67601794-67601816 TAGGAAATACAGGCCAGGTGCGG - Intergenic
1084256407 11:67946047-67946069 CAAGCAATGCAGGCCAGGTGTGG - Intergenic
1084382425 11:68821441-68821463 ACAAAAATGTAGGCCGGGCGCGG - Intronic
1084481340 11:69422353-69422375 TAAGAAAGGCAGGCCAGGCGTGG - Intergenic
1084499323 11:69525485-69525507 TCCGAAATGTTTACCAGGTGGGG - Intergenic
1084616755 11:70241423-70241445 TCAGAGAGATAGGCCAGGCGCGG - Intergenic
1084619542 11:70259979-70260001 TTAAAAACGAAGGCCAGGTGTGG - Intergenic
1084927817 11:72527829-72527851 TTAAAAATGTAGGCCAGGTGTGG + Intergenic
1085086247 11:73669524-73669546 ACAGAGATGGAGGCCGGGTGCGG + Intergenic
1085293503 11:75417305-75417327 TAAAAAATTTAGGCCAGGAGTGG + Intronic
1085351339 11:75799906-75799928 TAAAAAGTGTAGGCCAGGAGTGG - Intronic
1085370845 11:76003509-76003531 TCATTATTTTAGGCCAGGTGCGG - Intronic
1085498448 11:76994418-76994440 TATGAAAATTAGGCCAGGTGCGG - Intronic
1085563965 11:77496304-77496326 TAAAAAATACAGGCCAGGTGTGG - Intergenic
1086076240 11:82856013-82856035 AAAGAAAAATAGGCCAGGTGTGG + Intronic
1086394750 11:86403142-86403164 AAATAAATGCAGGCCAGGTGTGG - Intronic
1086618982 11:88861771-88861793 TTAGAACTGTGGGCCAGGTGTGG - Intronic
1086742755 11:90387600-90387622 TCAGTTATCTAGGCCGGGTGCGG - Intergenic
1086979924 11:93183986-93184008 TAAGAAAAGTTGGCCGGGTGCGG - Intronic
1087030903 11:93703252-93703274 GAAAAAATGTAGACCAGGTGCGG - Intronic
1087080242 11:94163137-94163159 TAAGAAAAATAAGCCAGGTGTGG - Intronic
1087165388 11:94998113-94998135 TGAGAACTGTAGGCGAGATGAGG - Exonic
1087168388 11:95026289-95026311 TGAGAACTGTAGGCGAGATGAGG - Exonic
1087170988 11:95050153-95050175 TGAGAACTGTAGGCGAGATGAGG - Intergenic
1087274655 11:96149121-96149143 ATTGAAAAGTAGGCCAGGTGTGG + Intronic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1087885736 11:103480152-103480174 TAAAAAATACAGGCCAGGTGTGG - Intergenic
1088219167 11:107549139-107549161 TCAGAATTTTAGGCTGGGTGCGG - Intronic
1088231018 11:107673291-107673313 TAAGAAATGAAGGCCAGGCGCGG + Intergenic
1088343407 11:108795117-108795139 AGAGAAAACTAGGCCAGGTGTGG - Intronic
1088491362 11:110391263-110391285 CCAGAAATACAGGCCAGGCGTGG + Intergenic
1088677174 11:112205887-112205909 CCAAAAATAGAGGCCAGGTGTGG - Intronic
1088949026 11:114546590-114546612 TCAGAAATATTGGCCAGGCATGG - Intronic
1089444176 11:118538600-118538622 TGAGAAATGTCGGCCAGGCATGG + Intronic
1089702414 11:120253547-120253569 TTAGAAATGTTGGCTGGGTGCGG - Intronic
1089992573 11:122875481-122875503 ACAGTAATATTGGCCAGGTGCGG + Intergenic
1090127374 11:124101497-124101519 AAAAAAATGTAGGCCAGGTGTGG + Intergenic
1090702689 11:129310664-129310686 TAAGATATGCCGGCCAGGTGCGG + Intergenic
1090723568 11:129499913-129499935 TAAGAAATAATGGCCAGGTGTGG + Intergenic
1090802741 11:130183248-130183270 TAAGAAATGTAGGCCGGGTGTGG - Intronic
1091212167 11:133871442-133871464 ACAGAAATGTAGGGAATGTGTGG + Intergenic
1091430596 12:430445-430467 TTAAAAAGGTAGGCCAGGTGTGG - Intronic
1091478309 12:799419-799441 ACAGACATGCAGGCCGGGTGCGG - Intronic
1091509302 12:1105645-1105667 TAATAAATCTTGGCCAGGTGCGG - Intronic
1091847864 12:3671150-3671172 GCAGAAATGCAGGCCAGCAGAGG + Intronic
1092087858 12:5779024-5779046 TCAGAAATGTTGGCTGGGTTGGG - Intronic
1092144710 12:6206512-6206534 TAAGAAATGTAGGCCAGGCGCGG - Intronic
1092220489 12:6709699-6709721 TTAAAAAATTAGGCCAGGTGTGG + Intergenic
1092303673 12:7277575-7277597 GAAACAATGTAGGCCAGGTGCGG - Intergenic
1092326949 12:7542782-7542804 ACAGAACTGAAGGCCAGGTGAGG + Intergenic
1092481533 12:8863393-8863415 TCAAAGATTTAGGCCGGGTGCGG - Intronic
1092542508 12:9429010-9429032 TAAGAAGGGTCGGCCAGGTGTGG - Intergenic
1092608669 12:10148751-10148773 TAAGAAATTTAGGCCAGGTGTGG - Intergenic
1092647149 12:10587829-10587851 TTATAAAAGTAGGCCAGGTAAGG + Intergenic
1092842716 12:12558668-12558690 TAAAAAATGTAGGCCAGGCGTGG - Intronic
1092879529 12:12877276-12877298 CCAGCATTGTAAGCCAGGTGAGG - Intergenic
1092881265 12:12889649-12889671 TGACATATGTGGGCCAGGTGTGG + Intergenic
1093452708 12:19333897-19333919 GAATAAATGAAGGCCAGGTGCGG - Intronic
1093752575 12:22817867-22817889 TTGGAAATTTAGGCCAGGCGTGG + Intergenic
1093946206 12:25112694-25112716 ACAGATGTGTAGGCTAGGTGTGG - Intronic
1094054107 12:26251150-26251172 TTAGAAATATAGGCTGGGTGCGG + Intronic
1094119022 12:26949420-26949442 GAAAAACTGTAGGCCAGGTGTGG - Intronic
1094211450 12:27897490-27897512 TAAAGAATGTGGGCCAGGTGCGG - Intergenic
1094541392 12:31365881-31365903 TAAGTAATGGAGGCCAGGTGTGG - Intergenic
1094685202 12:32705290-32705312 TCAAAAATTTGGGCCAAGTGTGG - Intronic
1094747318 12:33360393-33360415 TAAGAAAGATAGGCCAGATGTGG + Intergenic
1094827123 12:34278106-34278128 TAAAAAATATAGGCCAGGGGCGG + Intergenic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1095753286 12:45734076-45734098 TAAAAATTGGAGGCCAGGTGCGG + Intronic
1095894792 12:47269250-47269272 ACATATATGCAGGCCAGGTGGGG - Intergenic
1096018972 12:48306489-48306511 TCAGAAATCTAGGCCGGGCCTGG + Intergenic
1096142855 12:49256887-49256909 ACAGTAATTTAGGCCAGGAGCGG + Intronic
1096172977 12:49488365-49488387 TATGAAATACAGGCCAGGTGCGG + Intronic
1096305261 12:50469312-50469334 TAAAAAATGTAGGCCAGGTGCGG + Intronic
1096483913 12:51963526-51963548 TATGAAATGTCGGCCAGGCGTGG - Intronic
1096576657 12:52557040-52557062 TAAAAATTGTAGGCCGGGTGTGG + Intergenic
1096905906 12:54935163-54935185 TAAGAAATGTGGGCCGGGCGTGG - Intergenic
1097019838 12:56012561-56012583 AAAGTAATTTAGGCCAGGTGTGG - Intronic
1097866695 12:64565069-64565091 CCCAAAAAGTAGGCCAGGTGTGG - Intergenic
1098044065 12:66381941-66381963 TAAGAAAAGTTGACCAGGTGCGG + Intronic
1098276595 12:68818082-68818104 TTCCAAATGTAGGCCGGGTGTGG - Intronic
1098292710 12:68972377-68972399 TAAGAAATGTAGGCTGGGTGCGG - Intergenic
1098321229 12:69245793-69245815 ATGGAAGTGTAGGCCAGGTGCGG + Intronic
1098334880 12:69393310-69393332 ACAGAAAAATTGGCCAGGTGTGG + Intergenic
1098690684 12:73483331-73483353 CAAGAAATGGAGGCCGGGTGTGG - Intergenic
1098910084 12:76199984-76200006 ACAGAAATGAAAGCCAGCTGTGG + Intergenic
1098979971 12:76945435-76945457 TAAGAAATGTAGGCCAGGCGCGG - Intergenic
1098983259 12:76983073-76983095 TCAGAAATGAAGGAGAGGTAAGG - Intergenic
1099456142 12:82864789-82864811 TAAAAAATGTAGGCCGGGCGCGG - Intronic
1100119950 12:91358147-91358169 TCAAATATGTATGCCAGCTGAGG + Intergenic
1100514842 12:95317382-95317404 AAACAAATATAGGCCAGGTGCGG - Intergenic
1100534748 12:95497835-95497857 TAAAAAATGTAGGCCAGATGTGG + Intronic
1100920218 12:99476100-99476122 TAAAAATTGAAGGCCAGGTGCGG + Intronic
1101333468 12:103776263-103776285 TGAAAAAAGCAGGCCAGGTGCGG + Exonic
1101770303 12:107743822-107743844 CTAGAAAAATAGGCCAGGTGCGG + Intronic
1101957770 12:109225975-109225997 TTAAAATTATAGGCCAGGTGAGG + Intronic
1102134832 12:110565155-110565177 TAAAAAATATAGGCCAGGCGTGG - Intronic
1102257163 12:111422848-111422870 ACAAAAATTGAGGCCAGGTGAGG - Intronic
1102311639 12:111849550-111849572 AAAGAACTCTAGGCCAGGTGCGG - Intronic
1102356875 12:112244659-112244681 TAAGAAATTTGGGCCAGGTGTGG - Intronic
1102368385 12:112359707-112359729 AAAAAAATGTAGGCCAGGCGCGG - Intronic
1102377419 12:112434004-112434026 TCCTAGATGTGGGCCAGGTGTGG + Intronic
1102378658 12:112444628-112444650 TGAAACATGGAGGCCAGGTGCGG - Intronic
1102670890 12:114617874-114617896 TTAGAAATAAAAGCCAGGTGTGG - Intergenic
1103071091 12:117942788-117942810 TAAGAAATATAGGCTGGGTGGGG - Intronic
1103344351 12:120239291-120239313 ACAAAAATTTAGGCCAGGCGGGG + Intronic
1103390123 12:120566469-120566491 TGAAAAATTCAGGCCAGGTGTGG + Intronic
1103498999 12:121386043-121386065 TATTAAAAGTAGGCCAGGTGCGG - Intronic
1103503617 12:121425019-121425041 TGAGAAACTTGGGCCAGGTGTGG + Intronic
1103524041 12:121555662-121555684 TAAAAAATTTTGGCCAGGTGTGG - Intronic
1103577036 12:121885670-121885692 TCAGGAAATTTGGCCAGGTGCGG + Intergenic
1103664580 12:122552860-122552882 AGAGGAATATAGGCCAGGTGCGG + Intronic
1103689641 12:122761119-122761141 TAAAAAAAATAGGCCAGGTGCGG + Intronic
1103772841 12:123341816-123341838 TTAGTAATAGAGGCCAGGTGCGG - Intronic
1103836575 12:123825830-123825852 TTAGAAAAACAGGCCAGGTGTGG + Intronic
1104353606 12:128066279-128066301 TCAGAAAAGAAGGCCAGGTGAGG + Intergenic
1104471125 12:129030412-129030434 TTAGAAATTTAGGCAAGGCGTGG + Intergenic
1104751235 12:131240609-131240631 TCAGAAATTCAGGCCGGGCGCGG + Intergenic
1104761075 12:131297836-131297858 GCAGAAAGGCAGGCCTGGTGCGG + Intergenic
1104818702 12:131662956-131662978 GCAGAAAGGCAGGCCTGGTGCGG - Intergenic
1104913146 12:132249959-132249981 TGAGAACTGGAGGGCAGGTGCGG - Intronic
1105060435 12:133145517-133145539 TAAGGTATATAGGCCAGGTGCGG + Intronic
1105332182 13:19428156-19428178 TTAGAAAAATGGGCCAGGTGCGG + Intronic
1105339468 13:19506461-19506483 ACAAAGATTTAGGCCAGGTGCGG - Intronic
1105361050 13:19716897-19716919 TAAGAACTGTTGGCCAGGCGCGG + Intronic
1105374135 13:19828181-19828203 GCAGAGGTGTGGGCCAGGTGCGG + Intronic
1105495635 13:20928577-20928599 TTATAAGTTTAGGCCAGGTGTGG - Intergenic
1105693373 13:22864204-22864226 TGAGCAATGTCGGCCAGGCGCGG + Intergenic
1105744398 13:23363197-23363219 AAATAAATGTAGGCCAGGTGCGG - Intronic
1106007555 13:25785048-25785070 ATAGAAATGTAGGCCACGTGTGG - Intronic
1106124482 13:26889163-26889185 TCAAAAAAAAAGGCCAGGTGTGG + Intergenic
1106195733 13:27492413-27492435 ACAGAAATTTAGGCCAGGCGTGG - Intergenic
1106419699 13:29575995-29576017 CAAGAAATTTAGGCCACGTGTGG + Intronic
1106420844 13:29584435-29584457 TTACAAATATTGGCCAGGTGTGG - Intronic
1106608060 13:31250463-31250485 AAATAAATTTAGGCCAGGTGTGG - Intronic
1106813015 13:33378488-33378510 TTAGAAACATAGGCCAGGCGTGG + Intergenic
1107067419 13:36229831-36229853 TAATAATTATAGGCCAGGTGTGG - Intronic
1107072997 13:36292282-36292304 TGAAAAATGGAGGCCAGGTGCGG - Intronic
1107569510 13:41642267-41642289 TTGAAAATGCAGGCCAGGTGCGG + Intronic
1107616491 13:42173259-42173281 TATGAAATAAAGGCCAGGTGTGG - Intronic
1107745136 13:43496670-43496692 TAAGAAATGGAGGCTGGGTGTGG - Intronic
1107807565 13:44168808-44168830 TAAGAAATTTAGGCCGGGTGTGG + Intergenic
1107854269 13:44599305-44599327 ACAGAATTGGAGCCCAGGTGTGG - Intergenic
1107907533 13:45075059-45075081 TCAGAAAACAAGGCCAGGAGCGG + Intergenic
1108070088 13:46619398-46619420 TAAGAACTTTAGGCCAGGCGTGG - Intronic
1108526042 13:51286893-51286915 TAAAGAATCTAGGCCAGGTGCGG + Intergenic
1108555873 13:51591854-51591876 TCAGAAAAGCAGGCCAGGCCAGG - Intronic
1108638757 13:52362075-52362097 TAAGAATTGTTGGCCAGGCGCGG - Intergenic
1108731836 13:53243219-53243241 TAAAAAATATAGGCCAGGTGCGG - Intergenic
1108874774 13:55032417-55032439 ACAGACATTTAGGCCAGGCGCGG + Intergenic
1108922164 13:55689170-55689192 TAAAAAATCTAGGCCAGGCGTGG - Intergenic
1109056449 13:57555402-57555424 TAAGAGATTTAGGCCGGGTGCGG - Intergenic
1109495872 13:63170836-63170858 TAAAATATGTAGACCAGGTGAGG - Intergenic
1109631568 13:65055796-65055818 TCTAAAAAATAGGCCAGGTGCGG + Intergenic
1109656433 13:65396919-65396941 AGAAAAATGTTGGCCAGGTGCGG - Intergenic
1109866963 13:68277156-68277178 TTATAAATGTAGGCCAAGTATGG - Intergenic
1109921100 13:69060432-69060454 TAAGAAATTCAGGCCAGGCGTGG - Intergenic
1110273240 13:73614783-73614805 ATAAAAATTTAGGCCAGGTGTGG - Intergenic
1110512415 13:76366616-76366638 TAAAAAATCTTGGCCAGGTGTGG + Intergenic
1110846993 13:80201348-80201370 TCAGATCTGGTGGCCAGGTGTGG - Intergenic
1111059050 13:82988614-82988636 TCTGAAATCTAGGAAAGGTGTGG - Intergenic
1111298059 13:86309090-86309112 ATATAAATGTAGGCCGGGTGCGG + Intergenic
1111655606 13:91148903-91148925 ACAAAACTCTAGGCCAGGTGCGG + Intergenic
1111874689 13:93878666-93878688 TCTGAAGGGTAGGCCAGGAGCGG - Intronic
1111957282 13:94773579-94773601 TTAGAAATGTTGGCCAGGCATGG + Intergenic
1112002529 13:95224444-95224466 TAAGAAATGTTGGCCAGTCGTGG + Intronic
1112781876 13:102909542-102909564 TAAGAATCTTAGGCCAGGTGCGG - Intergenic
1112784501 13:102937389-102937411 TAACATAAGTAGGCCAGGTGTGG - Intergenic
1113748008 13:112758711-112758733 TAAGAAATGTAGGCTGGGAGCGG - Intronic
1113826632 13:113260258-113260280 ATTGAAATATAGGCCAGGTGTGG + Intronic
1113866134 13:113526427-113526449 TCAGCACAGTTGGCCAGGTGTGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114007464 14:18330631-18330653 TAACAAATGCAGGCCGGGTGCGG - Intergenic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1114265091 14:21069212-21069234 TGAGAAAGGAAGGCCAGATGGGG - Intronic
1114279611 14:21179595-21179617 TCACCAAAATAGGCCAGGTGTGG - Intergenic
1114416591 14:22548948-22548970 TAAGAAAAGCAGGCCGGGTGTGG - Intergenic
1114751925 14:25214293-25214315 TCTGAAATCTGGGCCAGTTGTGG + Intergenic
1114950215 14:27741228-27741250 TTAGAAATGTGGGCTGGGTGTGG - Intergenic
1115178497 14:30594397-30594419 TAAAAGATGTAGGCCGGGTGTGG + Intronic
1115219166 14:31042119-31042141 TAAGTAATGTTGGCCGGGTGCGG - Intronic
1115222506 14:31071706-31071728 TAAAAAATTTAGGCCGGGTGCGG - Intronic
1115544068 14:34449097-34449119 CAAAAAATGCAGGCCAGGTGTGG + Intronic
1115618100 14:35115450-35115472 AAAAAAATGTTGGCCAGGTGTGG - Intronic
1115844372 14:37510368-37510390 CCAAAAATATTGGCCAGGTGTGG - Intronic
1116082485 14:40192726-40192748 AGAGAAATAAAGGCCAGGTGCGG + Intergenic
1116381979 14:44280773-44280795 TAAGAATTTTAAGCCAGGTGTGG - Intergenic
1116448291 14:45037735-45037757 TCAGTAAAGATGGCCAGGTGTGG + Intronic
1116823594 14:49649434-49649456 AAAGAAATATAGGCCGGGTGTGG - Intronic
1116834749 14:49759226-49759248 TTAAAATTGTTGGCCAGGTGCGG + Intergenic
1116947192 14:50846864-50846886 TAAAAAGGGTAGGCCAGGTGCGG + Intergenic
1117150498 14:52882905-52882927 TGTAAAATCTAGGCCAGGTGTGG + Intronic
1117289895 14:54322146-54322168 TAAGAAGTTAAGGCCAGGTGTGG - Intergenic
1117818995 14:59629134-59629156 TAAGAAATGTATGCCAGTTGAGG - Intronic
1117926153 14:60781589-60781611 TCAAAATTTAAGGCCAGGTGTGG - Intronic
1117927169 14:60794372-60794394 ATAGAAATATAGGCCAGGAGTGG + Intronic
1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG + Intronic
1118120275 14:62832001-62832023 TTAGTAATTTAGGCCAAGTGTGG - Intronic
1118170351 14:63382689-63382711 TTAGAAGGGCAGGCCAGGTGTGG - Intronic
1118358228 14:65033565-65033587 TAAAAAAAGCAGGCCAGGTGCGG + Intronic
1118434159 14:65754222-65754244 TCAGAACTGTAGGACTTGTGGGG - Intergenic
1118567345 14:67156684-67156706 TACTACATGTAGGCCAGGTGCGG + Intronic
1118586132 14:67355100-67355122 TAAAAAATGCAGGCCAGGTGCGG - Intronic
1118665277 14:68062501-68062523 TCAGCAGTGGAGGCTAGGTGCGG + Intronic
1118959107 14:70512329-70512351 TTTAAAATGTAGGCCGGGTGAGG + Intergenic
1119660083 14:76444870-76444892 TCTGAAAATTGGGCCAGGTGTGG + Intronic
1119721051 14:76890762-76890784 TTAAAACTGCAGGCCAGGTGTGG + Intergenic
1119763687 14:77174199-77174221 TGAAAAATATAGGCCAGGTGCGG - Intronic
1120005110 14:79347709-79347731 AGGGAAATGTTGGCCAGGTGCGG - Intronic
1120199213 14:81518367-81518389 TAAAAAAGGTAGGCCGGGTGCGG + Intronic
1120360810 14:83499526-83499548 ACATAAGTGTGGGCCAGGTGTGG - Intergenic
1120452376 14:84684526-84684548 TAAGAATTATAGGCCAGGCGAGG + Intergenic
1120603935 14:86548396-86548418 AAAGTAATATAGGCCAGGTGCGG - Intergenic
1120798550 14:88663823-88663845 ATAGAAATGTTGGCCAGGTATGG - Intronic
1120982868 14:90306518-90306540 GCACTAATGTAGGCCGGGTGTGG + Intronic
1120990024 14:90367302-90367324 ACAGAAAAATAGGCCAGGCGTGG + Intergenic
1121188222 14:91996384-91996406 ATAAAAATGTAGTCCAGGTGAGG + Intronic
1121198089 14:92093175-92093197 ACTAAAATGTGGGCCAGGTGTGG - Intronic
1121198420 14:92096332-92096354 AAAGAAATGTAAGCCGGGTGTGG + Intronic
1121206180 14:92169981-92170003 TCAGAAAAATTGGCCAGGTGTGG + Exonic
1121388717 14:93555692-93555714 AAAGAAATCTTGGCCAGGTGTGG - Intronic
1121651215 14:95560322-95560344 ACAGAAATTTTGGCCGGGTGTGG + Intergenic
1121766938 14:96495769-96495791 TCAGTAATCTGGGCCAGGTGCGG + Intergenic
1122175311 14:99913465-99913487 TAAAGAATATAGGCCAGGTGTGG - Intronic
1122241532 14:100371460-100371482 AAAAAAAAGTAGGCCAGGTGTGG + Intronic
1122928076 14:104918615-104918637 TCAAAAATGCAGGCTGGGTGAGG - Intergenic
1123001641 14:105298562-105298584 CCACAGATTTAGGCCAGGTGCGG + Intronic
1123144408 14:106115049-106115071 TAATAAAACTAGGCCAGGTGTGG + Intergenic
1123391386 15:19877283-19877305 TAAAAAATGCAGGCCGGGTGCGG - Intergenic
1123415737 15:20093839-20093861 AAAAAAATGTAGGCCAGGCGCGG + Intergenic
1123525076 15:21100953-21100975 AAAAAAATGTAGGCCAGGCGCGG + Intergenic
1123692850 15:22853664-22853686 TGAAAAAAGTAGGCCGGGTGCGG - Intronic
1123702634 15:22927187-22927209 ACAAAAAACTAGGCCAGGTGCGG + Intronic
1123787662 15:23689001-23689023 TAAAATATTTAGGCCAGGTGCGG + Intergenic
1124348572 15:28938797-28938819 TACCACATGTAGGCCAGGTGCGG - Intronic
1124454032 15:29823795-29823817 TAAGAATTGTGGGCCAGGCGTGG + Intronic
1124510697 15:30322005-30322027 GCATAATTGAAGGCCAGGTGTGG - Intergenic
1124527322 15:30469312-30469334 TGAAAAATGTAGGCCGGGCGTGG + Intergenic
1124615047 15:31235502-31235524 TTAGAATTGAAGGCCATGTGCGG - Intergenic
1124771331 15:32538371-32538393 TGAAAAATGTAGGCCGGGCGTGG - Intergenic
1125018086 15:34957414-34957436 TAAAAAATGTAGGCCAGGCGTGG + Intronic
1125020069 15:34975748-34975770 TCAGAAATGTGGGCCGGGCATGG + Intergenic
1125108086 15:35997422-35997444 TTAAGAATGTTGGCCAGGTGCGG - Intergenic
1125473871 15:40030947-40030969 AAATAAATATAGGCCAGGTGCGG + Intronic
1125823862 15:42658820-42658842 AAAGAAAAGCAGGCCAGGTGTGG + Intronic
1125843931 15:42833580-42833602 TAAAAATTGTCGGCCAGGTGTGG + Intronic
1125857650 15:42965755-42965777 TTGGACATGTAGGCCGGGTGTGG - Intronic
1125981780 15:44008868-44008890 TCCGAAAAATATGCCAGGTGTGG + Intronic
1126214101 15:46133735-46133757 TCACAAATATAGGCCAGGTGTGG - Intergenic
1126305841 15:47256568-47256590 TAATAATTCTAGGCCAGGTGTGG + Intronic
1126636387 15:50784464-50784486 ATGAAAATGTAGGCCAGGTGTGG + Intergenic
1126752122 15:51886926-51886948 TAAGAAATTGGGGCCAGGTGCGG + Intronic
1126770928 15:52055115-52055137 TCAGAAAAACAAGCCAGGTGTGG + Intronic
1126978212 15:54209702-54209724 TATAAAATGTAGGCCTGGTGTGG - Intronic
1126989072 15:54350278-54350300 TTAGAAAAATAGGCCAGGCGTGG - Intronic
1127062538 15:55201652-55201674 CAAGAAATCTAGGCCAGGTGTGG - Intergenic
1127103595 15:55590282-55590304 AAAGAAATGAAGGCCAGCTGTGG + Intergenic
1127379987 15:58422473-58422495 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1127420751 15:58803524-58803546 TAGGAAATCTAGGCCAGATGCGG + Intronic
1127498205 15:59532139-59532161 TGAGAAATAGAGGCCGGGTGTGG + Intergenic
1127780054 15:62304857-62304879 AAAGAACTGTTGGCCAGGTGCGG + Intergenic
1127947849 15:63773150-63773172 TAATCAATGTAGGCCGGGTGTGG + Intronic
1128048540 15:64641502-64641524 GCACAAGTGTAGGCCAGGCGCGG - Intronic
1128059377 15:64724973-64724995 ACAAAAAATTAGGCCAGGTGCGG + Intergenic
1128083645 15:64871530-64871552 TCAAAAAAAAAGGCCAGGTGCGG - Intronic
1128272314 15:66321471-66321493 AAAAAAATGTAGGCCAGGCGTGG + Intronic
1128275489 15:66350115-66350137 TACAAAATTTAGGCCAGGTGTGG - Intronic
1128279429 15:66382672-66382694 CAAGAAATACAGGCCAGGTGTGG - Intronic
1128485272 15:68079767-68079789 TAAAAAGTTTAGGCCAGGTGTGG - Intronic
1128650798 15:69411620-69411642 TCCAAACTCTAGGCCAGGTGCGG + Intergenic
1128908394 15:71490133-71490155 TAAAAATTATAGGCCAGGTGTGG + Intronic
1128914060 15:71543735-71543757 TCACAGATGTGGGCCGGGTGTGG + Intronic
1129014810 15:72457139-72457161 AAAGAAAAGTAGGCCAGGCGTGG + Intergenic
1129086756 15:73102076-73102098 TCTGAATTTTAGTCCAGGTGCGG + Intronic
1129218814 15:74118945-74118967 TAATAAAAGCAGGCCAGGTGCGG - Intronic
1129347557 15:74933121-74933143 TCAGAAAACAAGGCCAGGTGCGG + Intronic
1129586732 15:76875348-76875370 ACACAAACGTAGGCCAGGCGTGG + Intronic
1129808405 15:78484074-78484096 TTATGACTGTAGGCCAGGTGCGG - Intronic
1129932356 15:79422259-79422281 TCAGATATGCAGGCCAGGCGTGG + Intronic
1130303253 15:82696285-82696307 TTCGAAATAGAGGCCAGGTGTGG + Intronic
1130308941 15:82735864-82735886 ATACCAATGTAGGCCAGGTGTGG + Intergenic
1130323615 15:82860644-82860666 TACAAAATGAAGGCCAGGTGTGG + Intronic
1130619477 15:85446976-85446998 TAATAAATTTAGGCCGGGTGTGG + Intronic
1130867972 15:87948395-87948417 TTAGTAATCAAGGCCAGGTGCGG + Intronic
1131074667 15:89487391-89487413 TCAGAATTTGGGGCCAGGTGTGG + Intronic
1131238849 15:90720872-90720894 TGAAAAAAGCAGGCCAGGTGCGG - Intronic
1131448597 15:92520137-92520159 TTATAAATATAGGCCAGGTGCGG + Intergenic
1131673763 15:94650000-94650022 AGAAAGATGTAGGCCAGGTGCGG - Intergenic
1131740951 15:95390792-95390814 AAATCAATGTAGGCCAGGTGCGG + Intergenic
1131819810 15:96260856-96260878 TGAAGAATGTAGGCCAGGTGCGG + Intergenic
1131822684 15:96288940-96288962 TTAGAGATACAGGCCAGGTGCGG + Intergenic
1131836250 15:96394390-96394412 TAAGAAATGTAGTGCAGGAGTGG - Intergenic
1132103379 15:99044457-99044479 TGACAAAATTAGGCCAGGTGCGG + Intergenic
1132353078 15:101152482-101152504 GTAGTAGTGTAGGCCAGGTGCGG - Intergenic
1132581970 16:688917-688939 GCAGAAATTGAGGCTAGGTGTGG - Intronic
1133090971 16:3403459-3403481 ACAAAAAGCTAGGCCAGGTGTGG - Intronic
1133179133 16:4039386-4039408 GCAGGATTGCAGGCCAGGTGCGG + Intronic
1133240910 16:4413893-4413915 TGTAAAATGTGGGCCAGGTGCGG + Intronic
1133868289 16:9664397-9664419 AAATCAATGTAGGCCAGGTGCGG + Intergenic
1133914084 16:10093126-10093148 TCAGAAAGGTTGGCCGGGCGTGG - Intronic
1133977491 16:10609918-10609940 TCAGAAATTTAGGCCAGGCACGG + Intergenic
1134132824 16:11661220-11661242 AGGAAAATGTAGGCCAGGTGCGG - Intergenic
1134278430 16:12797258-12797280 AAAAAAATTTAGGCCAGGTGCGG + Intronic
1134411977 16:14010714-14010736 TCAGAAATGAAGGCCAGGCATGG - Intergenic
1134526085 16:14944892-14944914 AAAAAAATATAGGCCAGGTGCGG - Intronic
1134592038 16:15462440-15462462 ATAAAAATGCAGGCCAGGTGTGG - Intronic
1134595882 16:15495654-15495676 TAATAAAAGTAGGCCAGGCGCGG - Intronic
1134627422 16:15732251-15732273 TTAAAAAAGTAGGCCAGGCGTGG - Intronic
1134818907 16:17229554-17229576 TGAGAGAAGTAGGCCAGGTGGGG + Intronic
1134953152 16:18365288-18365310 AAAAAAATATAGGCCAGGTGCGG + Intergenic
1135006394 16:18827134-18827156 TAAAAAATATAGGCCGGGTGCGG + Intronic
1135110010 16:19683211-19683233 TAAGAAGGGAAGGCCAGGTGTGG - Intronic
1135554207 16:23422750-23422772 TTAGTAATCTAGGTCAGGTGTGG + Intronic
1135580903 16:23625502-23625524 TAAAAAATATAGGCCAGGTGTGG + Intronic
1135793606 16:25421189-25421211 ACAGAAAAATGGGCCAGGTGTGG - Intergenic
1135820508 16:25681200-25681222 TAAGATATGTAGGCCGGGTGCGG + Intergenic
1136001387 16:27296832-27296854 CCACAGATGTAGGCCAGGCGCGG - Intergenic
1136138459 16:28273198-28273220 TCTGAAAGAGAGGCCAGGTGCGG - Intergenic
1136358072 16:29759628-29759650 TCAAAAAAAAAGGCCAGGTGAGG - Intergenic
1136533582 16:30886128-30886150 TAAAAACTGTAGGCTAGGTGTGG - Intronic
1136571185 16:31097873-31097895 TCAGCAAATTAGGCCAGGTGTGG - Intergenic
1136604874 16:31326705-31326727 AAAGCAATGAAGGCCAGGTGCGG - Intronic
1136706332 16:32190940-32190962 AAAGAAATAAAGGCCAGGTGTGG + Intergenic
1136761577 16:32738477-32738499 AAAGAAATAAAGGCCAGGTGTGG - Intergenic
1136806525 16:33131913-33131935 AAAGAAATAAAGGCCAGGTGTGG + Intergenic
1136959262 16:34826937-34826959 TTAGAAATCTAGGCCGGGCGCGG - Intergenic
1137283136 16:46994967-46994989 AAAGACATATAGGCCAGGTGCGG - Intergenic
1137285162 16:47009738-47009760 AAATAAAAGTAGGCCAGGTGTGG - Intergenic
1137413925 16:48254614-48254636 TCAGAGATGGAGGCCGGGCGTGG - Intronic
1137985811 16:53107142-53107164 AAATAAATGTAGGCCAGGCGTGG + Intronic
1138326742 16:56178498-56178520 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
1138511117 16:57508877-57508899 TCAGGAGCGTGGGCCAGGTGCGG + Intergenic
1138555540 16:57769324-57769346 TCAAACATGCAGGCCAGGCGCGG - Intronic
1138682889 16:58699046-58699068 TAAAAAATATAGGCCAGGCGTGG - Intergenic
1139235769 16:65337329-65337351 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1139322261 16:66124641-66124663 TATGAAATTTCGGCCAGGTGCGG - Intergenic
1139424700 16:66872257-66872279 TAAGAAAAGTAGGCCAGAGGCGG + Intronic
1139644736 16:68320112-68320134 GCAGAGATGTAGGCCAGGTTAGG + Intronic
1139759659 16:69174423-69174445 ATAGAAAAGTAGGCCAAGTGTGG + Intronic
1139798075 16:69499042-69499064 AAAAAAATGTTGGCCAGGTGTGG + Intergenic
1139878399 16:70164567-70164589 TAAGGATTTTAGGCCAGGTGCGG + Intergenic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1140293091 16:73682493-73682515 AAAGAAAGGTAGGCCGGGTGCGG + Intergenic
1140346468 16:74218209-74218231 TCTGAGATGTTGGCCAGGTGCGG - Intergenic
1140359165 16:74330249-74330271 TAAGGATTTTAGGCCAGGTGCGG - Intergenic
1140394054 16:74612123-74612145 AGAGATATGGAGGCCAGGTGCGG + Intergenic
1140531794 16:75673142-75673164 TCTGATTTGGAGGCCAGGTGTGG + Intronic
1140536671 16:75715986-75716008 ACAGAAATGTGGGCCAGATGTGG - Intronic
1140689161 16:77464761-77464783 ACAGATAAATAGGCCAGGTGCGG - Intergenic
1140948315 16:79791973-79791995 GCAGAAATGGAGGCCTGGAGTGG - Intergenic
1141084742 16:81085301-81085323 AAAGAAATGTAGGCCAGGCACGG - Intronic
1141109123 16:81257553-81257575 TAACACATCTAGGCCAGGTGCGG - Intronic
1141825142 16:86473392-86473414 TCAGAAGTCTAGGCCAGGCATGG - Intergenic
1142039502 16:87883618-87883640 TACGAAAAGTAGGCCGGGTGCGG - Exonic
1203063732 16_KI270728v1_random:998792-998814 AAAGAAATAAAGGCCAGGTGTGG - Intergenic
1142642399 17:1291918-1291940 CAGGAAATGTAGGCCAGGCGCGG + Intronic
1142826829 17:2518163-2518185 GCTGACATGGAGGCCAGGTGCGG - Intergenic
1143124023 17:4629832-4629854 TAAGAAATAAAGGCCGGGTGCGG + Intergenic
1143140139 17:4737839-4737861 AAAGAAAAATAGGCCAGGTGTGG + Intronic
1143163936 17:4888342-4888364 TTGAAAATATAGGCCAGGTGAGG + Intronic
1143206132 17:5140272-5140294 TAAAAAATTTAGGCCGGGTGTGG + Intronic
1143210171 17:5180358-5180380 TAATGAGTGTAGGCCAGGTGCGG - Exonic
1143224900 17:5292997-5293019 TTATAAATATTGGCCAGGTGTGG + Intronic
1143454365 17:7056644-7056666 ACAGAAATTTGAGCCAGGTGTGG - Intergenic
1143501001 17:7338835-7338857 TAAAAAATTCAGGCCAGGTGTGG - Intronic
1143657647 17:8305653-8305675 TAAGAAATACAGGCCAGGCGCGG + Intergenic
1143665649 17:8357818-8357840 ATAGAAAATTAGGCCAGGTGTGG - Intergenic
1143948923 17:10617654-10617676 TCATTAATCAAGGCCAGGTGCGG + Intergenic
1144013564 17:11172652-11172674 TTAAAAATGTCGGCCAGGCGCGG + Intergenic
1144507093 17:15841330-15841352 AGTGAAATGTCGGCCAGGTGCGG - Intergenic
1144644395 17:16962214-16962236 AAAGAAAGGTAGGCCAGGTGTGG + Intronic
1144689343 17:17249916-17249938 TTAAAAAGGTAGGCCAGATGTGG - Intronic
1144769234 17:17750163-17750185 TGGGAAATGTAGTCCAGCTGTGG + Intronic
1144963267 17:19058955-19058977 ACAGAAATGTAGGCCGGGCATGG + Intergenic
1144964423 17:19067085-19067107 ACAGAAATGTAGGCCGGGCATGG - Intergenic
1144971892 17:19115570-19115592 ACAGAAATGTAGGCCGGGCATGG - Intergenic
1144983545 17:19185088-19185110 CCAGAAATGTAGGCCGGGCATGG + Intergenic
1144984680 17:19193151-19193173 CCAGAAATGTAGGCCGGGCATGG - Intergenic
1145025941 17:19467824-19467846 AAAAAAAAGTAGGCCAGGTGCGG - Intergenic
1145036686 17:19545778-19545800 TAAGAATTGTTGGCCAGGTGTGG - Intronic
1145057264 17:19711299-19711321 AAAGAAATGCAGGCCAGGCGTGG + Intronic
1145098910 17:20057149-20057171 ACAGAAAGGTTGGCCGGGTGCGG + Intronic
1145171219 17:20658927-20658949 AGTGAAATGTCGGCCAGGTGCGG - Intergenic
1145745868 17:27319238-27319260 TAAGAAGTTTTGGCCAGGTGTGG - Intergenic
1145762223 17:27431687-27431709 TAAGAAATTTAGGCCAGGTGTGG + Intergenic
1146012576 17:29207592-29207614 CCAGAAAAGAAGGCCAGGTGTGG - Intergenic
1146016365 17:29236963-29236985 AAAAATATGTAGGCCAGGTGCGG + Intergenic
1146148522 17:30445172-30445194 TTAAAAACCTAGGCCAGGTGCGG + Intronic
1146189736 17:30754197-30754219 GCAAAAAATTAGGCCAGGTGCGG + Intergenic
1146334639 17:31958555-31958577 CCAAAAAATTAGGCCAGGTGCGG + Intronic
1146376268 17:32296622-32296644 GAAGAGATCTAGGCCAGGTGCGG - Intronic
1146724381 17:35145885-35145907 TAAGAAATGTGGGCCAGGCGCGG + Intergenic
1146805523 17:35862162-35862184 TTAGAAAATTAGGCCAGGCGTGG - Intronic
1146842480 17:36165556-36165578 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1146854790 17:36253515-36253537 TAAGAAATTTAGGCCGGGTGTGG - Intronic
1146865830 17:36334861-36334883 TAAGAAATTTAGGCCGGGTGTGG + Intronic
1146870690 17:36377407-36377429 TAAGAAATTTAGGCCGGGTGTGG - Intronic
1146878048 17:36428488-36428510 TAAGAAATTTAGGCCGGGTGTGG - Intronic
1146881989 17:36449592-36449614 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1146900223 17:36580627-36580649 TCTGAAATTTAGGCCAGATATGG + Intronic
1147033042 17:37656891-37656913 TCTATAATGTAGGCCAGGTATGG + Intergenic
1147068700 17:37935473-37935495 TAAGAAATTTAGGCCGGGTGTGG + Intergenic
1147073573 17:37978031-37978053 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1147080223 17:38015010-38015032 TAAGAAATTTAGGCCGGGTGTGG + Intronic
1147085095 17:38057569-38057591 TAAGAAATTTAGGCCGGGTGTGG - Intronic
1147096171 17:38138970-38138992 TAAGAAATTTAGGCCGGGTGTGG + Intergenic
1147101041 17:38181535-38181557 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1147451503 17:40507705-40507727 ACAGATATATAGGCCAGGTGTGG + Intergenic
1147537477 17:41330053-41330075 TAAGAAATTTAGGCCAGGTGTGG + Intergenic
1147735428 17:42634457-42634479 TCAACACTGTAGGCCGGGTGCGG - Intergenic
1147747991 17:42707547-42707569 TAAAAAAATTAGGCCAGGTGTGG - Intronic
1147774221 17:42889158-42889180 TGATATAAGTAGGCCAGGTGTGG - Intergenic
1147887335 17:43692973-43692995 TTAGCTATGTGGGCCAGGTGCGG - Intergenic
1148007659 17:44447124-44447146 CATGAAATGGAGGCCAGGTGCGG - Intronic
1148032951 17:44634817-44634839 ATAGAAACATAGGCCAGGTGTGG - Intergenic
1148158863 17:45438710-45438732 ACACAAAAGTAAGCCAGGTGTGG - Intronic
1148191988 17:45685680-45685702 AAAGAACTGAAGGCCAGGTGCGG - Intergenic
1148374835 17:47133732-47133754 AAATATATGTAGGCCAGGTGTGG - Intronic
1148414311 17:47494356-47494378 TTAAAAAATTAGGCCAGGTGCGG + Intergenic
1148447777 17:47749702-47749724 TATAAAATGTTGGCCAGGTGTGG - Intergenic
1148740298 17:49889062-49889084 TCAGGAGGGTAGGCCGGGTGCGG + Intergenic
1148954195 17:51339870-51339892 AAAGAAATGTAGGCTGGGTGTGG - Intergenic
1149019425 17:51945933-51945955 TAAGAAATTCAGGCCAGATGAGG + Intronic
1149505744 17:57192422-57192444 ACAGAAAAGAAGGACAGGTGTGG + Intergenic
1149672444 17:58426959-58426981 AAAAAAATGTTGGCCAGGTGCGG + Intronic
1149706633 17:58700728-58700750 TAAAAACTTTAGGCCAGGTGTGG - Intronic
1149766514 17:59283316-59283338 AAACAAATGCAGGCCAGGTGCGG - Intergenic
1149802978 17:59587746-59587768 TAAGAAAATTAGGCCAGGCGTGG - Intronic
1149843508 17:59987732-59987754 TAAGAAAATTAGGCCAGGCGTGG + Intergenic
1149845632 17:60007998-60008020 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1150025702 17:61672026-61672048 TTAAAAATCTAGGTCAGGTGTGG - Intergenic
1150083981 17:62264581-62264603 TAAGAAATTTAGGCCGGGTGTGG - Intergenic
1150121339 17:62605712-62605734 TCATATATTTTGGCCAGGTGTGG + Intronic
1150235270 17:63587828-63587850 AAAGTAATATAGGCCAGGTGCGG + Intronic
1150390217 17:64785792-64785814 ACACAAAAGTAAGCCAGGTGTGG - Intergenic
1150554779 17:66244571-66244593 TTAAAGATTTAGGCCAGGTGGGG - Intronic
1150702709 17:67461634-67461656 TTAGAACTGTAGGCTGGGTGTGG + Intronic
1151171855 17:72253258-72253280 TAAGAGATGTGGGCTAGGTGTGG - Intergenic
1151511070 17:74560543-74560565 AAAAAAATGTAGGCCGGGTGCGG - Intergenic
1151539174 17:74756237-74756259 AAAGAAAAATAGGCCAGGTGTGG - Intronic
1151584043 17:74997734-74997756 TAAGAATTTTAGCCCAGGTGTGG + Intronic
1151738978 17:75966166-75966188 TAAAAAATAAAGGCCAGGTGCGG + Intronic
1152129835 17:78469457-78469479 TAAGAAACACAGGCCAGGTGCGG + Intronic
1152137400 17:78512649-78512671 TAATCAATGGAGGCCAGGTGCGG + Intronic
1152208328 17:78988782-78988804 TTAAGAAAGTAGGCCAGGTGCGG - Intergenic
1152210379 17:79000089-79000111 TCAGAAATGCAGGTAAGGGGGGG - Intronic
1152668311 17:81585371-81585393 TAAGAAATCAAGGCCGGGTGTGG + Intronic
1152719404 17:81915520-81915542 GCAGAAAGGAAGGCAAGGTGAGG + Intronic
1153023244 18:651118-651140 AAAGAAATGTAGGCCAGGCACGG + Intronic
1153307548 18:3646103-3646125 TTAAAAAAGGAGGCCAGGTGTGG + Intronic
1153655060 18:7274824-7274846 GAAAAAATGCAGGCCAGGTGTGG - Intergenic
1153873665 18:9345358-9345380 TTAGAGTTTTAGGCCAGGTGTGG + Intronic
1154038569 18:10832005-10832027 ACAGAGTTGGAGGCCAGGTGCGG + Intronic
1154229245 18:12539636-12539658 TAAGAAAAATAGGCCAAGTGTGG + Intronic
1154241242 18:12656187-12656209 ACAGCAATGTCTGCCAGGTGCGG - Intronic
1154311722 18:13272182-13272204 TCAGCACTGAGGGCCAGGTGTGG - Intronic
1154998323 18:21662395-21662417 TCTAAAAGGTGGGCCAGGTGTGG - Intronic
1155002326 18:21699202-21699224 TGTGTAAAGTAGGCCAGGTGTGG - Intronic
1155090241 18:22501949-22501971 ACAGAAAAGGAGGCCTGGTGTGG + Intergenic
1155458190 18:26044612-26044634 TGAAAAATCTTGGCCAGGTGTGG - Intronic
1155483612 18:26316673-26316695 TTAGAAATGTAAGCCAGGCACGG - Intronic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1155512026 18:26588134-26588156 TAAGAAATTGTGGCCAGGTGTGG + Intronic
1155636290 18:27959857-27959879 TCATGGATTTAGGCCAGGTGTGG + Intronic
1156317182 18:35980930-35980952 TAATAATTGTAGGCCAGGCGTGG - Intergenic
1156542141 18:37924870-37924892 TTACAAATATTGGCCAGGTGTGG + Intergenic
1156940398 18:42760065-42760087 TTAAAAATATAGGCCAGGTGCGG - Intronic
1156945606 18:42827713-42827735 AGAAAAATGTAGGCCAGGCGTGG + Intronic
1157263668 18:46198009-46198031 TGAAAATTGTGGGCCAGGTGTGG + Intronic
1157309207 18:46539168-46539190 ACAGATTTGCAGGCCAGGTGTGG + Intronic
1157612692 18:48968332-48968354 ACAGAAATGTAGACCAATTGAGG - Intergenic
1157765590 18:50294551-50294573 TAAGAAATGTGGGCCAGGTGCGG - Intergenic
1157835526 18:50898721-50898743 TAAGAAATTTTGGCCAGGTGTGG - Intronic
1158224797 18:55189780-55189802 TAAAAAATGTAGGCCAGGCATGG - Intergenic
1158264066 18:55640305-55640327 ACATATATATAGGCCAGGTGCGG - Intronic
1158465432 18:57685955-57685977 ACACAATTGTAGGCCGGGTGTGG + Intronic
1158516424 18:58134289-58134311 TAAGAATATTAGGCCAGGTGCGG - Intronic
1158573727 18:58618335-58618357 TGTGATATGTAGGCCAGGCGGGG - Intronic
1158607713 18:58910763-58910785 TGAGAATTTCAGGCCAGGTGCGG - Intronic
1158709896 18:59828263-59828285 ACAGTAAAATAGGCCAGGTGTGG + Intergenic
1159066492 18:63573775-63573797 TTTAAAATGTTGGCCAGGTGTGG + Intergenic
1159236433 18:65680036-65680058 TGAAAATTCTAGGCCAGGTGTGG + Intergenic
1159342828 18:67159012-67159034 AAAGAAATCTTGGCCAGGTGCGG - Intergenic
1159469034 18:68825406-68825428 TCAGTAAATTAGGCCAGGCGGGG + Intronic
1159680406 18:71343095-71343117 TCAGAAATGTTGGGCATGTGTGG + Intergenic
1160178762 18:76616890-76616912 TAAGAAAAATAGGCCGGGTGCGG + Intergenic
1160230625 18:77046220-77046242 TCAGAGATGTTGGCTAGATGAGG + Intronic
1160311720 18:77798403-77798425 ACAGAATTCTAGGTCAGGTGTGG - Intergenic
1160702816 19:516671-516693 TGAGAAATGTTGGCCAGGCACGG - Intronic
1160709804 19:545931-545953 ACAGAAATTAAGGCCGGGTGCGG - Intronic
1160819928 19:1053191-1053213 TTAAGAACGTAGGCCAGGTGCGG - Intronic
1160889539 19:1369937-1369959 TGAAGAATGTAGGCCAGGTGCGG + Intronic
1161021768 19:2014446-2014468 CCAGGGATGCAGGCCAGGTGGGG + Intronic
1161044121 19:2125710-2125732 ACAGAAATGTAGGCCGGGCGCGG + Intronic
1161146157 19:2679596-2679618 TCTGGAATGTAGGCATGGTGAGG - Intronic
1161539081 19:4838869-4838891 TCAGGAATATAGGCCGGGTGCGG - Exonic
1161630209 19:5350717-5350739 AGAGACATTTAGGCCAGGTGTGG + Intergenic
1161636297 19:5391359-5391381 ACAGAAAGGAGGGCCAGGTGCGG - Intergenic
1161654335 19:5504537-5504559 TGGGCAAAGTAGGCCAGGTGAGG - Intergenic
1161721617 19:5905710-5905732 TAATAAATTTAGGCCGGGTGCGG - Intronic
1161792204 19:6366946-6366968 TCAAAAAGTGAGGCCAGGTGTGG + Intronic
1161845336 19:6708975-6708997 TTTGGAATGGAGGCCAGGTGCGG - Intronic
1161877399 19:6922323-6922345 TCAGAGGTGTTGGCCGGGTGTGG + Intronic
1161917914 19:7243534-7243556 GAAAAAATTTAGGCCAGGTGCGG - Intronic
1161968578 19:7562546-7562568 ACAAAAATTAAGGCCAGGTGTGG - Intergenic
1162041897 19:7975814-7975836 AGGGAAATTTAGGCCAGGTGTGG + Intronic
1162513625 19:11135075-11135097 TAAGAAATGAAAGCCGGGTGTGG + Intronic
1162641397 19:12013095-12013117 AAAGAAATGTGGGTCAGGTGCGG - Intergenic
1162721012 19:12662973-12662995 TTAAAAATAGAGGCCAGGTGCGG + Intronic
1162759391 19:12879811-12879833 TACAAAAAGTAGGCCAGGTGTGG + Intronic
1162863158 19:13523761-13523783 AGAAAAATGGAGGCCAGGTGTGG + Intronic
1162983129 19:14251695-14251717 TTATAAATTTTGGCCAGGTGCGG - Intergenic
1163084598 19:14970359-14970381 TAAGAAAATCAGGCCAGGTGAGG - Intronic
1163323545 19:16588527-16588549 TCAGTGCTGGAGGCCAGGTGCGG - Intronic
1163340011 19:16699688-16699710 TAAGAAATTTAGGACATGTGTGG - Intergenic
1163353381 19:16793865-16793887 ACATAAAAGTTGGCCAGGTGTGG - Intronic
1163420469 19:17211269-17211291 TCAGAAATAAAGGCCGAGTGCGG - Intronic
1163490321 19:17613998-17614020 ACAAAAAAGAAGGCCAGGTGCGG - Intronic
1163562538 19:18028716-18028738 TTTAAAATGTAGGCCAGGTATGG + Intergenic
1163620232 19:18355257-18355279 TCAAAAAAAAAGGCCAGGTGCGG - Intronic
1163704742 19:18805647-18805669 TCTGGGTTGTAGGCCAGGTGTGG - Intergenic
1163718788 19:18888067-18888089 TAAGAAATGGAGGCCAACTGAGG + Intronic
1163759602 19:19128518-19128540 AAAAAAATGTAGGCCAGGTGTGG - Intronic
1163788669 19:19292409-19292431 AAAGAAAAATAGGCCAGGTGTGG + Intronic
1164025299 19:21346334-21346356 TAGAAATTGTAGGCCAGGTGTGG + Intergenic
1164109534 19:22142522-22142544 AAAGAAAAGTTGGCCAGGTGTGG - Intergenic
1164230089 19:23279598-23279620 GAAAAAAAGTAGGCCAGGTGTGG - Intergenic
1164284484 19:23800900-23800922 GTAGAAATCTAGGCCAGGTGAGG - Intronic
1164512238 19:28907122-28907144 TGAGAAATTGTGGCCAGGTGCGG - Intergenic
1164675221 19:30096068-30096090 CTAGAAATATAGGCCGGGTGCGG + Intergenic
1164982511 19:32624964-32624986 TAAAAAATAAAGGCCAGGTGCGG + Intronic
1165056957 19:33183634-33183656 TAAAAAATGTAGGCTGGGTGTGG - Intronic
1165184858 19:34009177-34009199 TCAAAAATGTTGGCCAGGTATGG - Intergenic
1165194775 19:34093389-34093411 TAAGGTATGTAGGCCAGGTGTGG + Intergenic
1165201767 19:34150566-34150588 TTAGAATTCTAGGCCAGGTGCGG - Intergenic
1165235947 19:34421797-34421819 TAAGAAATTTAGGCCAGGTGTGG + Intronic
1165241759 19:34474409-34474431 CCAAAAATGTGGGCCAGGTGAGG + Intergenic
1165245657 19:34497151-34497173 TCAGAAAAGAAGGCCTGGTGTGG - Intronic
1165328407 19:35127077-35127099 TCAGAGATGTAGGCAAACTGAGG - Intronic
1165368545 19:35386451-35386473 TAAAAAATTTAGGACAGGTGGGG - Intergenic
1165503617 19:36210128-36210150 AAGGAAATGGAGGCCAGGTGTGG + Intronic
1165591934 19:36975982-36976004 TAAGAAATTGAGGCCAGGCGTGG - Intronic
1165715050 19:38039171-38039193 TCAGAAATGCAGGCTAGGCAAGG - Intronic
1165836233 19:38758098-38758120 TCAGGGATACAGGCCAGGTGTGG - Intronic
1166011480 19:39945932-39945954 ACAAAAATTAAGGCCAGGTGCGG - Intergenic
1166089793 19:40501376-40501398 AAACAAATATAGGCCAGGTGCGG + Intronic
1166190013 19:41170280-41170302 TTAGAAAAATAGGCCAGGTGCGG + Intergenic
1166216544 19:41339407-41339429 TCAAACCTGAAGGCCAGGTGCGG - Intronic
1166547955 19:43645462-43645484 ACAGAAACTTAGGCCAGGTGTGG - Intergenic
1166571650 19:43800669-43800691 TCATATATGGAGGCCAGGGGTGG + Intronic
1166581613 19:43905276-43905298 TCTGAAATGCTGGCCGGGTGTGG - Intergenic
1166627850 19:44376681-44376703 TTAAAAATGTAGGCTGGGTGCGG + Intronic
1166820398 19:45575894-45575916 TAATAAATTTAGGGCAGGTGCGG - Intronic
1166820407 19:45575941-45575963 TCTGAAATGGGGGCCAGTTGTGG + Intronic
1166861098 19:45811724-45811746 ATACAAATGTTGGCCAGGTGCGG - Intronic
1166889156 19:45979778-45979800 TTAAAATTGCAGGCCAGGTGTGG - Intergenic
1167227218 19:48254460-48254482 AAAGAAATGCAGGCCTGGTGCGG + Intronic
1167239516 19:48334939-48334961 TGAAAACTGTAGGCCAGATGGGG - Intronic
1167304193 19:48697371-48697393 TCAGTAAGATAGACCAGGTGTGG + Intronic
1167354632 19:48995693-48995715 TAAGAAAATTAGGCCGGGTGCGG + Intronic
1167490729 19:49791563-49791585 TCTGAAATGTAAGCCCTGTGAGG + Intronic
1167580591 19:50339397-50339419 TCAGAAAAATAGGCCAGCTGTGG + Intronic
1167700041 19:51037829-51037851 TCAGAAATTTAACCAAGGTGGGG + Intergenic
1167756920 19:51418491-51418513 TTTGAATTTTAGGCCAGGTGCGG - Intergenic
1167842928 19:52136770-52136792 AGAGACATCTAGGCCAGGTGTGG + Intronic
1167950877 19:53026719-53026741 AAAAAAGTGTAGGCCAGGTGTGG + Intergenic
1168032013 19:53687853-53687875 ATACAAATGTAGGCCAGGTGTGG - Intergenic
1168331696 19:55573794-55573816 AGAAAAAAGTAGGCCAGGTGCGG + Intergenic
1168503595 19:56914326-56914348 TATGTAATATAGGCCAGGTGTGG + Intergenic
1202696347 1_KI270712v1_random:129543-129565 AAAAAAATGCAGGCCAGGTGTGG + Intergenic
925227864 2:2201407-2201429 TCATAAGTGTTGGCCGGGTGCGG + Intronic
925292656 2:2758027-2758049 TGATAAATGGAGGCCAGGAGTGG - Intergenic
925459845 2:4051493-4051515 TCAAAAATCTAGGCTGGGTGTGG + Intergenic
925575378 2:5355004-5355026 TCAGAAACGCAGACCAGGAGGGG + Intergenic
925932366 2:8719304-8719326 TAAGAAATGAGGGCCGGGTGTGG + Intergenic
926105588 2:10147852-10147874 TCAGAGACTTAGACCAGGTGTGG + Intronic
926191648 2:10732680-10732702 AAAGAAATGAAGGCCAGGCGCGG + Intronic
926314353 2:11698230-11698252 TCAGGAATGAGGGCCACGTGCGG - Intronic
926564945 2:14458864-14458886 CCAAAAATCTTGGCCAGGTGTGG + Intergenic
927262532 2:21106821-21106843 TCATAAATACAGGCCAGGCGTGG - Intergenic
927621563 2:24666302-24666324 ATAAAAAAGTAGGCCAGGTGCGG - Intronic
927648163 2:24892952-24892974 AAAGAAAAATAGGCCAGGTGTGG - Intronic
927762341 2:25770462-25770484 TAAAAAATCTAGGCCAGGTGCGG + Intronic
927986776 2:27416944-27416966 ACAGAAAAATAAGCCAGGTGTGG + Intergenic
928056537 2:28061966-28061988 CCAGGATTGTTGGCCAGGTGCGG + Intronic
928329316 2:30345746-30345768 AAAGCAATGAAGGCCAGGTGCGG + Intergenic
928574634 2:32642541-32642563 AAACAAATTTAGGCCAGGTGCGG - Intronic
928579397 2:32691587-32691609 TAAGAGATGCAGGCCAGGCGCGG - Intronic
928641432 2:33303638-33303660 TAACCAATGCAGGCCAGGTGCGG - Intronic
928643430 2:33324993-33325015 TTAAAAATAGAGGCCAGGTGCGG - Intronic
928646314 2:33356387-33356409 TCAGAAATGTCTGCCGGGCGAGG + Intronic
928790978 2:34952662-34952684 TTAAAAATATTGGCCAGGTGCGG - Intergenic
929320970 2:40542850-40542872 TAAAAAGTTTAGGCCAGGTGCGG - Intronic
929477684 2:42268726-42268748 TAAAAAATGTAGGCCAGGTGCGG - Intronic
929518104 2:42622780-42622802 TCTTACATGGAGGCCAGGTGTGG - Intronic
929926127 2:46211345-46211367 AAAAAAATCTAGGCCAGGTGAGG - Intergenic
930589217 2:53307395-53307417 TAAAATATGTTGGCCAGGTGTGG + Intergenic
930589465 2:53310231-53310253 TAAGAAATCTTGGCCAGGCGTGG + Intergenic
930629451 2:53736406-53736428 TTAAAATTGGAGGCCAGGTGCGG + Intronic
930633277 2:53777854-53777876 TAAGCAATCTTGGCCAGGTGTGG + Intronic
930777156 2:55184393-55184415 ACAGGAATGTTGGCCAGGTGTGG - Intronic
930888600 2:56356921-56356943 ACAAAAAAGTAGGCCAGGCGTGG + Intronic
931314300 2:61112781-61112803 TAAGAAAATTAGGCCTGGTGAGG - Intronic
931345379 2:61440806-61440828 TTAAAAAAGTAGGCCGGGTGTGG - Intronic
931388383 2:61817674-61817696 AAAGAAACATAGGCCAGGTGCGG + Intergenic
931391187 2:61845530-61845552 TAAAGAATGGAGGCCAGGTGTGG + Intronic
931394976 2:61879566-61879588 TGAGAAGTATCGGCCAGGTGCGG - Intronic
931541616 2:63335574-63335596 TAAGAAATCCTGGCCAGGTGTGG - Intronic
931655574 2:64508428-64508450 TTACATATGTGGGCCAGGTGTGG - Intergenic
931658504 2:64533105-64533127 TAATAGATCTAGGCCAGGTGTGG + Intronic
931668357 2:64625858-64625880 TCAGAGATGGAGGGCAGGAGCGG + Intergenic
931863302 2:66380344-66380366 TAAAAAATGGAGGCCAGATGCGG - Intergenic
932092644 2:68819861-68819883 TCTGAAATGTAGACCTCGTGAGG + Intronic
932323761 2:70840654-70840676 TCAGAAATGCAGGAGAGGTTGGG - Intergenic
932979508 2:76647336-76647358 TAAGAATTGTAGGCCGGGCGCGG - Intergenic
933650320 2:84845058-84845080 TAAGAACTTTAGGCCAGGCGCGG + Intronic
933867379 2:86533785-86533807 TTAAGAATGAAGGCCAGGTGTGG - Intronic
933895222 2:86805091-86805113 AAAAAAATTTAGGCCAGGTGTGG - Intronic
934072905 2:88401673-88401695 TCAAAAAATTAGGCCGGGTGCGG + Intergenic
934277508 2:91586572-91586594 AAAAAAATGCAGGCCAGGTGTGG + Intergenic
934960206 2:98666400-98666422 TCAGAATTTAAGGCCGGGTGTGG + Intronic
935202495 2:100870187-100870209 TCAGGAGTCTGGGCCAGGTGCGG - Intronic
935522394 2:104123404-104123426 TTAAACATTTAGGCCAGGTGAGG - Intergenic
935890818 2:107675942-107675964 AAAGTAATGCAGGCCAGGTGTGG + Intergenic
936037208 2:109122577-109122599 ACAGTAATTTAGGCCAGCTGTGG + Intergenic
936600198 2:113888536-113888558 TGAGAAATGAAGGCGAGGAGTGG - Intergenic
936851303 2:116901045-116901067 TTAAAAAAATAGGCCAGGTGTGG - Intergenic
936953911 2:118005471-118005493 TAAGAAGCATAGGCCAGGTGCGG + Intronic
937513175 2:122621376-122621398 TGAAAAATATAGGCCAGGCGCGG - Intergenic
937712142 2:124990281-124990303 AAAAAAATTTAGGCCAGGTGCGG + Intergenic
937831992 2:126434305-126434327 TCACATATGTAGACCAGGTGTGG + Intergenic
937874403 2:126810493-126810515 TTAGAAATAAAGGCCAGGCGTGG - Intergenic
938575203 2:132597065-132597087 TCAAAAATGAAGGAGAGGTGAGG + Intronic
938578181 2:132622822-132622844 TAAGACCTGTTGGCCAGGTGCGG + Intronic
938852698 2:135277632-135277654 TATAAAATATAGGCCAGGTGCGG + Intronic
939112301 2:138022729-138022751 TATTATATGTAGGCCAGGTGTGG - Intergenic
939335367 2:140820268-140820290 AAATTAATGTAGGCCAGGTGTGG - Intronic
939404788 2:141742542-141742564 ACAGAACTGGAGGCCAGGCGTGG - Intronic
939410517 2:141818824-141818846 ACAGAAATGTTATCCAGGTGCGG - Intronic
939481004 2:142747234-142747256 TCAGAAAATTAGGCCGGTTGCGG + Intergenic
939827870 2:147036990-147037012 TAAAAAAAGTTGGCCAGGTGTGG - Intergenic
940076933 2:149751957-149751979 ACAGACATGTAGGCCAGGTGTGG - Intergenic
940141388 2:150494982-150495004 TCAGAAATCTTGGCATGGTGAGG + Intronic
940209594 2:151242774-151242796 ACAAAAATGTAGGGCAGGTGTGG - Intergenic
940304967 2:152215873-152215895 TCAGGAATGTAAGCCAACTGAGG - Intergenic
940384805 2:153058139-153058161 CCAGGAATGGCGGCCAGGTGTGG + Intergenic
940819919 2:158341603-158341625 AAAAATATGTAGGCCAGGTGTGG - Intronic
940919153 2:159288223-159288245 ATTGAAATGGAGGCCAGGTGCGG + Intergenic
940959563 2:159769350-159769372 GAAAAAATGTAGGCCAAGTGTGG + Exonic
941001432 2:160207032-160207054 AAAGAAATGCAGGCCAGATGTGG + Intronic
941134682 2:161699308-161699330 TAATAAATGTCGGCCGGGTGCGG - Intronic
941625799 2:167829191-167829213 ATAGATATCTAGGCCAGGTGCGG + Intergenic
941733495 2:168946138-168946160 TTTGTAATTTAGGCCAGGTGAGG + Intronic
941927800 2:170913753-170913775 TCAGTAATCATGGCCAGGTGTGG - Intergenic
942230556 2:173857696-173857718 TTAGAATTCTAGGCCAGGCGCGG + Intergenic
942487872 2:176458190-176458212 TCAGACATGTATCTCAGGTGTGG - Intergenic
942649625 2:178153513-178153535 TCAGAGACATAGGCCAGGTGTGG + Intergenic
942730015 2:179053383-179053405 TCAGTCATGAAGGTCAGGTGTGG + Intergenic
943648601 2:190432705-190432727 ACAGAGATTTTGGCCAGGTGCGG - Intronic
944062564 2:195584535-195584557 TTAGAAATTAAGGCCAGGTGTGG + Intronic
944225109 2:197341791-197341813 TTGAAAATGTGGGCCAGGTGCGG + Intergenic
944227516 2:197363221-197363243 TTAAAACTCTAGGCCAGGTGCGG + Intergenic
944247825 2:197549839-197549861 TTAGAAATTAAGGCCAGGTGTGG - Intronic
944546921 2:200808059-200808081 TCAAAAATCGAGTCCAGGTGTGG + Intergenic
944586385 2:201177458-201177480 TGAGTAATGTAGGCTGGGTGTGG - Intergenic
944657326 2:201889104-201889126 GCAGAAGTTTAGGCCAGGCGAGG + Intronic
944771892 2:202922949-202922971 TCAGCAAAGAAGGCCAGGCGAGG + Intronic
944795120 2:203176432-203176454 ACAGTAAAGTAGGCCAGGTGTGG + Intronic
944799114 2:203219563-203219585 CCAAAAATGTGGGCCGGGTGTGG + Exonic
944830487 2:203529262-203529284 TCAGTAGAGCAGGCCAGGTGCGG - Intronic
945097908 2:206237048-206237070 ACAAAAATTAAGGCCAGGTGTGG + Intergenic
945131848 2:206582166-206582188 TAAGAAATGTTGGCCGGGCGTGG - Intronic
945189977 2:207177920-207177942 TGAGTAAGGTGGGCCAGGTGAGG + Intergenic
945345071 2:208703555-208703577 TTAAAAATCTTGGCCAGGTGTGG - Intronic
945472107 2:210239053-210239075 AAAGAGAGGTAGGCCAGGTGTGG - Intergenic
945620745 2:212133672-212133694 ACATAAAGGAAGGCCAGGTGTGG + Intronic
945866304 2:215180021-215180043 TACTAGATGTAGGCCAGGTGTGG - Intergenic
946027338 2:216679723-216679745 CCAGAAATGTAGGCCCGGAGGGG + Intronic
946237974 2:218336769-218336791 AAAGAATTGAAGGCCAGGTGTGG - Intronic
946315886 2:218911935-218911957 TCAGAGTTGTAGGCCAGGTGTGG + Intergenic
946663631 2:222027544-222027566 AAAGCAATGTAGGCCGGGTGTGG + Intergenic
946758086 2:222966318-222966340 TTAGAAATCCTGGCCAGGTGTGG + Intergenic
946836880 2:223781443-223781465 TCAATAATCTTGGCCAGGTGTGG + Intronic
946925655 2:224624343-224624365 ACACAAAAGTAGGCCAGGGGCGG - Intergenic
947017865 2:225641522-225641544 TTGATAATGTAGGCCAGGTGCGG + Intronic
947157518 2:227177443-227177465 TTAGAAAAATAGGCCAGGTGAGG - Intronic
947296070 2:228631970-228631992 TCAGGAAGGTCGGCCGGGTGTGG + Intergenic
947396014 2:229687554-229687576 TTGGAAATTTGGGCCAGGTGTGG - Intronic
947511364 2:230757385-230757407 ACAGAAATACAGGCCAGGTGAGG - Intronic
947638169 2:231690948-231690970 TCTCAAAAGAAGGCCAGGTGTGG - Intergenic
947676714 2:231988131-231988153 TAAGAAAAATAGGCCAGGTGCGG - Intronic
947803198 2:232945040-232945062 TCAAAACTATAGGCCAGGCGTGG - Intronic
947853611 2:233308052-233308074 TCAGAAACCTGGGGCAGGTGTGG + Intronic
947960805 2:234235637-234235659 TGAAAAATGGAGGCCAGGTGCGG + Intergenic
947969992 2:234315361-234315383 TTTGAAATCTAGGCCAGGTGTGG - Intergenic
948427993 2:237900449-237900471 GAAGCAATATAGGCCAGGTGCGG - Intronic
949005502 2:241644578-241644600 TCAGAAGTGTTGGCCGGGCGCGG + Intronic
949005511 2:241644657-241644679 TCAGAAGTGTCGGCCGGTTGCGG + Intronic
949015662 2:241708495-241708517 TAAGAAAACTAGGCCAGGCGTGG - Intronic
1168784365 20:525219-525241 TTATAAACTTAGGCCAGGTGTGG + Intronic
1169108239 20:3015594-3015616 TAAGAAATCCAGGCCAGGCGTGG - Intronic
1169265957 20:4167579-4167601 TCAGAGGTGTTGGCCAAGTGGGG + Intronic
1169280603 20:4263775-4263797 AAAGCAATGTTGGCCAGGTGTGG - Intergenic
1169479250 20:5962662-5962684 TAAGAAATGAAGGCCGGGCGCGG - Intronic
1169531261 20:6487718-6487740 TAAAATATGTAGGCCAGGTGTGG + Intergenic
1169821927 20:9721355-9721377 GCAAGAATGTTGGCCAGGTGTGG + Intronic
1169885260 20:10391561-10391583 TCAGAACTGCAGGCTAGGTGTGG + Intergenic
1170379411 20:15740574-15740596 TCAGAAATGCAGGGCAAGTCTGG - Intronic
1170597177 20:17814913-17814935 TCAGAAATGAGGGTGAGGTGTGG - Intergenic
1170879492 20:20283564-20283586 TCAGAAATGCAGGCAAGGTGTGG + Intronic
1171506101 20:25634972-25634994 TAAGAAACTCAGGCCAGGTGTGG - Intergenic
1171816338 20:29788891-29788913 TCAGAAGTCAAGGCCGGGTGCGG + Intergenic
1171987010 20:31667564-31667586 TTGGAAATGTAGGCCCAGTGTGG - Intronic
1172137412 20:32696499-32696521 GAAGAAATCCAGGCCAGGTGTGG - Intergenic
1172251838 20:33485121-33485143 TAAGAATATTAGGCCAGGTGCGG - Intergenic
1172542288 20:35728075-35728097 TAAGAATTGTAGGCCAGGCCCGG - Intronic
1172581651 20:36053064-36053086 ATAAAAATGCAGGCCAGGTGCGG - Intergenic
1172597545 20:36160291-36160313 TCAGAAGTGTAGGCCAGGCACGG + Intronic
1172658737 20:36552266-36552288 TAAAAAATTAAGGCCAGGTGTGG - Intergenic
1172746219 20:37211345-37211367 TTAGAGATGGGGGCCAGGTGTGG + Intronic
1172923337 20:38506582-38506604 GCAGAAACCTAGGCCAGGCGTGG - Intronic
1173283872 20:41653492-41653514 TCTTATATTTAGGCCAGGTGTGG + Intergenic
1173425285 20:42937381-42937403 TCAGAAATGAGGGCCATGTCTGG + Intronic
1173531078 20:43770186-43770208 TAAGAATTAGAGGCCAGGTGTGG - Intergenic
1173971389 20:47155144-47155166 TGAAAAATCTTGGCCAGGTGCGG - Intronic
1174030332 20:47619352-47619374 AAAGAAATGTAGGCTGGGTGTGG + Intronic
1174228471 20:49024261-49024283 TCTGATATGTAGGCCAGGCATGG - Intronic
1174798378 20:53541473-53541495 TCAGAAATATGGGCCAGGTGCGG - Intergenic
1174826944 20:53777000-53777022 ACAAAAATTTAGGCCAGGTGCGG + Intergenic
1174961216 20:55159236-55159258 TCAGCAGCGAAGGCCAGGTGGGG - Intergenic
1175006325 20:55687301-55687323 TAAGAAGAGTAGGCCAGGCGTGG + Intergenic
1175152914 20:56949154-56949176 ATAGAAATGTAGGCTGGGTGCGG - Intergenic
1175187955 20:57191405-57191427 AAAGAAATGTAGGCCAGGTGTGG + Intronic
1175264614 20:57695198-57695220 AAAGGAATGCAGGCCAGGTGAGG + Intronic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1175561113 20:59932383-59932405 TAAAAAATGTAGGCCGGGCGAGG + Intronic
1175849449 20:62081072-62081094 TTATGAATGTTGGCCAGGTGCGG + Intergenic
1177222041 21:18207614-18207636 TCAGTATTGTAGGACAGGTCTGG + Intronic
1177284794 21:19035770-19035792 TAAGAATTTTAGGCCAAGTGTGG - Intergenic
1177286750 21:19061549-19061571 TTATGAATATAGGCCAGGTGTGG - Intergenic
1177962228 21:27681387-27681409 TCAAAAATCTAGGCCAACTGAGG - Intergenic
1178107713 21:29338657-29338679 TTAAAAATGTAGGCCAGGCATGG - Intronic
1178273846 21:31218275-31218297 TCTCAAATGTAGGCCAGGTGCGG + Intronic
1178323182 21:31621684-31621706 ATATATATGTAGGCCAGGTGTGG + Intergenic
1178330084 21:31682132-31682154 CCTAAAAAGTAGGCCAGGTGCGG + Intronic
1178424972 21:32471916-32471938 TAAGAAATGGAGGCCGAGTGCGG - Intronic
1178828775 21:36037687-36037709 TCAAAAATGGAGCCCAGATGCGG + Intronic
1179208568 21:39306357-39306379 AAAGATATCTAGGCCAGGTGCGG - Intronic
1179442478 21:41405016-41405038 TCAAAAGCCTAGGCCAGGTGTGG + Intronic
1179513382 21:41889932-41889954 TCAGGGATATAAGCCAGGTGTGG - Intronic
1179710865 21:43212226-43212248 TCAGGATTGAAGCCCAGGTGTGG - Intergenic
1179769937 21:43606994-43607016 ACAGAACTGGAGGCCAGGTGTGG + Intronic
1179839448 21:44061555-44061577 TAAAAAATACAGGCCAGGTGCGG - Intronic
1179915674 21:44476653-44476675 ACAGAGATGAAGGCAAGGTGAGG + Intergenic
1180319779 22:11309409-11309431 TCAGAAGTAAAGGCCGGGTGCGG + Intergenic
1180431971 22:15261439-15261461 TAACAAATGCAGGCCGGGTGTGG - Intergenic
1180624228 22:17183371-17183393 TCAGTTTTGCAGGCCAGGTGCGG - Intronic
1180781807 22:18524608-18524630 TAAAAAATATTGGCCAGGTGTGG + Intergenic
1180795557 22:18602965-18602987 TTAAAAAAGTAGGCCAGGTGCGG - Intergenic
1180941563 22:19662646-19662668 TAAGAATTTTAGGCCAGGTGCGG - Intergenic
1181004632 22:20006918-20006940 TCAAAAGGGTAGGCCAGGCGCGG - Intronic
1181101611 22:20544373-20544395 ACAGAAATTTAGGCCGGGTGCGG + Intronic
1181226172 22:21392307-21392329 TTAAAAAAGTAGGCCAGGTGCGG + Intergenic
1181238693 22:21463951-21463973 TAAAAAATATTGGCCAGGTGTGG + Intergenic
1181252465 22:21542509-21542531 TTAAAAAAGTAGGCCAGGTGCGG - Intergenic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181724180 22:24799914-24799936 TAAGAAAAATAGGCCAGGTGTGG - Intergenic
1181817704 22:25451017-25451039 TAAGAAGTATAGGCCGGGTGCGG - Intergenic
1181843659 22:25687944-25687966 AAAGCAATTTAGGCCAGGTGCGG + Intronic
1181916131 22:26281666-26281688 AAAGAAAAGAAGGCCAGGTGCGG - Intronic
1182002472 22:26931279-26931301 TTAAAAATTAAGGCCAGGTGTGG - Intergenic
1182258080 22:29052402-29052424 TTAAAAATGTTGGCCGGGTGCGG + Intronic
1182468187 22:30531115-30531137 AAGGAACTGTAGGCCAGGTGCGG + Intronic
1182539633 22:31031429-31031451 TAAGAAAATCAGGCCAGGTGTGG - Intergenic
1182544348 22:31065638-31065660 AAAAAAATGTAGGCCAGGCGCGG - Intronic
1182544523 22:31067044-31067066 TTAAAATTGCAGGCCAGGTGTGG - Intronic
1182610248 22:31541464-31541486 TTAGAATTGTAGGCCAGGCGTGG + Intronic
1182785492 22:32904182-32904204 TGGGAAATGTAGTCCAGATGGGG - Intronic
1183195081 22:36348216-36348238 TCAAAAAAACAGGCCAGGTGCGG + Intronic
1183837772 22:40470656-40470678 ACAGAAAAACAGGCCAGGTGTGG + Intronic
1183923460 22:41187892-41187914 TAAGCAATTCAGGCCAGGTGCGG + Intergenic
1184125596 22:42484434-42484456 ACAGAAAGGGAGGCCAGGCGTGG - Intergenic
1184144146 22:42598672-42598694 AGAGAAATATGGGCCAGGTGCGG - Intronic
1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG + Intronic
1184435236 22:44469626-44469648 CCAGAAAAATAGGCCAGGCGTGG - Intergenic
1184496385 22:44844751-44844773 AAAGAAATGTTGGCCAGGTGCGG - Intronic
1184542607 22:45138791-45138813 TAAGGAATAAAGGCCAGGTGTGG + Intergenic
1185006508 22:48279939-48279961 TAATAAATATAGCCCAGGTGTGG + Intergenic
1185257012 22:49839835-49839857 TTAAAAATCTAGGCCAGGCGTGG + Intergenic
1185356719 22:50377161-50377183 TCACAAATTCAGGCCAGGTGAGG + Intronic
949183862 3:1167383-1167405 TCTGAAATGTTGCCCAGATGGGG + Intronic
949273744 3:2253795-2253817 TAAGAAATCTTGACCAGGTGTGG - Intronic
949658258 3:6247132-6247154 GAATAAATGTGGGCCAGGTGCGG + Intergenic
949704735 3:6803370-6803392 TAAGAAAAGTGGGCCAGGTGCGG - Intronic
950076213 3:10189127-10189149 GGATAAATGTAGGTCAGGTGGGG + Intronic
950317457 3:12016564-12016586 TTAGGGATGTAGGCCAGGCGTGG + Intronic
950344578 3:12280873-12280895 TCAGAAATGTAGAGCAGGGAGGG + Intergenic
950378839 3:12594025-12594047 TCAGAAATAAAGGTGAGGTGAGG + Intronic
950783950 3:15417164-15417186 TTAAAAAAATAGGCCAGGTGCGG + Intronic
950900003 3:16489125-16489147 TCAGTGATGGAGGCCGGGTGAGG + Intronic
951363928 3:21757431-21757453 TAATAAATTTAGGCCAGGTGTGG - Intronic
951535594 3:23737886-23737908 TAAGAAAAGCAGGCCAGGTGTGG + Intergenic
951593066 3:24287420-24287442 TGAGCAATGTAGGCCAAGAGTGG + Intronic
951763704 3:26173141-26173163 TAAAAATTGAAGGCCAGGTGTGG - Intergenic
951764316 3:26180054-26180076 AGAAAAATGTAGGCCGGGTGCGG - Intergenic
951892303 3:27578775-27578797 AAAGAAAAGCAGGCCAGGTGCGG + Intergenic
951969302 3:28425817-28425839 ATATACATGTAGGCCAGGTGCGG + Intronic
952417355 3:33101491-33101513 TTAGAAAAATAGGCCGGGTGTGG - Intergenic
952633371 3:35497269-35497291 TAAGAAAAATAGGCCAGGTGTGG + Intergenic
952662066 3:35863744-35863766 ACAAAAATGTAGGCTGGGTGCGG - Intergenic
952771015 3:37000437-37000459 TAAGAAATTAAGGCCAGGTGTGG + Intronic
952812044 3:37412674-37412696 TAAGAAAAATAGGCCAGGCGCGG + Intronic
953277151 3:41513345-41513367 TCAGCAGAGTTGGCCAGGTGTGG + Intronic
953504908 3:43475890-43475912 ACAAATTTGTAGGCCAGGTGTGG - Intronic
953716989 3:45324053-45324075 TAGGAGATGGAGGCCAGGTGCGG - Intergenic
953747584 3:45586839-45586861 TTTAAAATGTGGGCCAGGTGCGG - Intronic
953770642 3:45776591-45776613 TCAGACATGCAGGACAGCTGTGG + Intronic
953948312 3:47167376-47167398 GAAGAAATGTAGACCGGGTGCGG + Intergenic
954068173 3:48123558-48123580 CAAGAAATGTATGCCAGGTGCGG - Intergenic
954118391 3:48479879-48479901 GTGGAAATGTAGGCCAGGTGTGG - Intronic
954160850 3:48720900-48720922 TAATAAACCTAGGCCAGGTGTGG + Intronic
954166171 3:48760065-48760087 ACAAAAATGTAGGCCAGGTGTGG + Intronic
954190054 3:48953218-48953240 TCAGAATTGCTGGCCAGGCGCGG - Intronic
954227657 3:49193078-49193100 TTAAAAATGTTGGCCAGGTGCGG + Intergenic
954255794 3:49404955-49404977 TAAAAAAAGTAGGCCAGGCGCGG + Intronic
954643573 3:52116895-52116917 TTAAAAAATTAGGCCAGGTGCGG + Intronic
954657772 3:52207291-52207313 ACAAAAAGTTAGGCCAGGTGCGG - Intronic
955182417 3:56683972-56683994 GAACAAATGGAGGCCAGGTGCGG - Intergenic
955235578 3:57136292-57136314 ACACATATGTAGCCCAGGTGTGG + Intronic
955468887 3:59265260-59265282 TCAGAAAAACAGGCCGGGTGTGG - Intergenic
955501107 3:59584024-59584046 AAAGAAATGTAGGCCAGGTACGG + Intergenic
955758458 3:62251356-62251378 CAAAAAATGTAAGCCAGGTGTGG + Intronic
955772249 3:62396939-62396961 TTAAAATTGTAGGCCGGGTGCGG + Intergenic
956560542 3:70569774-70569796 TGAAAAAGGTAGGCCAGGCGCGG - Intergenic
957323031 3:78656639-78656661 TCAAACAAATAGGCCAGGTGCGG - Intronic
957842197 3:85685912-85685934 TAAGAAATAAAGGCCAGGCGTGG - Intronic
957858383 3:85909012-85909034 TCACAACTGTAGGCCGGGCGTGG - Intronic
957908745 3:86592454-86592476 TAAGAAATCTAGGCTGGGTGCGG - Intergenic
958255700 3:91322198-91322220 AAAGAAATGGAGGCCAGCTGTGG + Intergenic
958657852 3:97025876-97025898 ACTTAAATGTAGGCCAGGTGTGG - Intronic
958864117 3:99481317-99481339 AATGAAATGGAGGCCAGGTGTGG + Intergenic
959493083 3:107015620-107015642 TTAAAAATTTAGGCCAGGTGCGG - Intergenic
959616940 3:108359328-108359350 AAATAAATGTTGGCCAGGTGGGG + Intronic
959669129 3:108955020-108955042 AGAGAACTGTAGGCCAGGTGTGG - Intergenic
960377182 3:116917701-116917723 AAAGAAAAGTCGGCCAGGTGTGG + Intronic
960572897 3:119203050-119203072 TCTGATATCTAGGCCAGGCGTGG + Intronic
960802779 3:121555852-121555874 TTAGAAATCTGGGCCAGGAGCGG - Intergenic
960888373 3:122419594-122419616 TTAGAAATGAAGGCCGGGCGCGG + Intergenic
961365922 3:126399127-126399149 TGAGGGATGTAGGGCAGGTGGGG - Intronic
961481084 3:127181179-127181201 GCAGAAAGGTAGGCCTGGAGGGG + Intergenic
962112062 3:132461981-132462003 ACTAAAATGGAGGCCAGGTGTGG - Intronic
962523682 3:136219567-136219589 ACAGTAATGTGGGTCAGGTGTGG + Intergenic
962556544 3:136558099-136558121 TTAAAAATCTTGGCCAGGTGCGG + Intronic
962758840 3:138489654-138489676 AAAGAAAACTAGGCCAGGTGTGG - Intergenic
962932686 3:140052444-140052466 ACAGAAATATTGGCCAGGTGCGG - Intronic
963030973 3:140975608-140975630 TGAGAAATTTTGGCCAGTTGTGG - Intronic
963162604 3:142167081-142167103 GTATTAATGTAGGCCAGGTGTGG + Intronic
964097671 3:152951845-152951867 TTACAAATTTAGGCCAGGTATGG + Intergenic
964340752 3:155706329-155706351 ACAAAAAATTAGGCCAGGTGCGG + Intronic
964347473 3:155769020-155769042 ACAAAAATTAAGGCCAGGTGTGG + Intronic
964358061 3:155868634-155868656 ACAGACTTGTTGGCCAGGTGCGG - Intergenic
964756813 3:160096319-160096341 TCAGAAAAGTAAGGCAGGGGAGG - Intergenic
965579410 3:170251617-170251639 TAAGAAATTAGGGCCAGGTGTGG + Intronic
965856944 3:173101178-173101200 TCAATGATCTAGGCCAGGTGAGG - Intronic
966160578 3:176963212-176963234 TAAAAATTGTTGGCCAGGTGCGG - Intergenic
966189732 3:177261196-177261218 TAAGAGACATAGGCCAGGTGTGG - Intergenic
966276176 3:178172830-178172852 TAAGAATTCTAGGCCGGGTGTGG + Intergenic
966379667 3:179331486-179331508 GCACAACTTTAGGCCAGGTGCGG + Intronic
966557090 3:181274826-181274848 TAAGGTATATAGGCCAGGTGCGG + Intergenic
966717321 3:183026419-183026441 TTAAAAATGCAGGCCAGGTGCGG + Intronic
966728055 3:183125956-183125978 TAAGAAATATAGGCCAAGTGTGG - Intronic
966869213 3:184279017-184279039 AAAGAAGTTTAGGCCAGGTGCGG + Intronic
966999129 3:185314960-185314982 TGATACATGTTGGCCAGGTGCGG + Intronic
967307023 3:188069278-188069300 ACAGAAATATCAGCCAGGTGTGG - Intergenic
967341941 3:188408076-188408098 ACATAAATGAGGGCCAGGTGCGG - Intronic
967349291 3:188494270-188494292 CCATACATGTATGCCAGGTGAGG + Intronic
967461289 3:189749831-189749853 AAAGGAATGAAGGCCAGGTGCGG + Intronic
967871383 3:194232659-194232681 CAATAATTGTAGGCCAGGTGTGG + Intergenic
968127672 3:196171731-196171753 ACTGCAATGTGGGCCAGGTGCGG - Intergenic
968184975 3:196626401-196626423 TTTCAAATTTAGGCCAGGTGCGG + Intergenic
968205601 3:196797172-196797194 TCAAAAATGTTGGCCAGGCACGG + Intronic
968360197 3:198141390-198141412 ACAGAGATGTAGGCCAGGCACGG - Intergenic
968617657 4:1586483-1586505 TCAGAAGTTGAGGCCAGGCGCGG + Intergenic
968833884 4:2948743-2948765 TGTGAAATGTGGGCCAGGTGCGG - Intronic
968843350 4:3024568-3024590 AAAAAATTGTAGGCCAGGTGTGG + Intronic
969033240 4:4229776-4229798 AAAAAAATGCAGGCCAGGTGGGG - Intergenic
969083121 4:4635451-4635473 AAAAAAATCTAGGCCAGGTGTGG - Intergenic
969367050 4:6702009-6702031 TCAGAATTGTTGGCCAGGCGTGG - Intergenic
969582319 4:8072458-8072480 TCAGAAACGCGGGGCAGGTGAGG + Intronic
969739004 4:9010540-9010562 CAAGCAATGCAGGCCAGGTGTGG + Intergenic
969798202 4:9542162-9542184 CAAGCAATGCAGGCCAGGTGTGG + Intergenic
970016929 4:11522111-11522133 CCAGAAATTAAGGGCAGGTGTGG - Intergenic
970322575 4:14889477-14889499 TCAGAAATGCAGGCCATGAATGG + Intergenic
971104867 4:23513670-23513692 TCAGAAAAATAGGCAAGGAGAGG + Intergenic
971270686 4:25141887-25141909 TCAGGACTCTAGGCCAGATGTGG - Intronic
971284557 4:25275092-25275114 ACAGAAACGTTGACCAGGTGTGG - Intronic
971308104 4:25501421-25501443 TAAGAAATGGAGGCCAGGCGAGG + Intergenic
971315250 4:25562299-25562321 TAAGAACTTAAGGCCAGGTGTGG - Intergenic
971398690 4:26254990-26255012 TTAAACATGTTGGCCAGGTGCGG - Intronic
971791937 4:31181258-31181280 TCAAAGATTTCGGCCAGGTGTGG + Intergenic
971872485 4:32261610-32261632 TAACAAAATTAGGCCAGGTGTGG - Intergenic
972388870 4:38593702-38593724 TAAGAGTAGTAGGCCAGGTGTGG - Intergenic
972505017 4:39712708-39712730 TTAAAAATGTAGGCCGAGTGCGG - Intronic
972680516 4:41302133-41302155 AAAGAAAACTAGGCCAGGTGCGG - Intergenic
972737712 4:41861300-41861322 TCAGAAATTTAGGCCAACTTTGG + Intergenic
972738799 4:41870937-41870959 TCAGAAATGTAGGCCAGAGAAGG - Intergenic
972743382 4:41909888-41909910 CTGGAAATGCAGGCCAGGTGTGG + Intergenic
972798340 4:42445787-42445809 GAAGAGATATAGGCCAGGTGTGG + Intronic
973137730 4:46728380-46728402 ACAGATGTGTAGGCCAGGTGTGG + Intergenic
973310830 4:48708108-48708130 AAAGAAATACAGGCCAGGTGTGG - Intronic
973713716 4:53654427-53654449 TCAGAAAGGTAAGGTAGGTGGGG + Intronic
973752034 4:54030821-54030843 TTAGCATTTTAGGCCAGGTGCGG - Intronic
974041310 4:56860297-56860319 AAAGAAAACTAGGCCAGGTGCGG + Intergenic
974364453 4:60928041-60928063 CCAAATATGTAGGCCAGGTGTGG + Intergenic
974708649 4:65558165-65558187 TAAGAATTTTGGGCCAGGTGTGG - Intronic
974729359 4:65841491-65841513 AAAGAAAAATAGGCCAGGTGTGG - Intergenic
974730103 4:65852792-65852814 TTACAAATCTAGGCAAGGTGTGG + Intergenic
974769286 4:66389654-66389676 TAAGAAATGTGGGCCAGGCATGG - Intergenic
975119867 4:70716551-70716573 ACAGCATTGAAGGCCAGGTGCGG + Intronic
975246515 4:72127010-72127032 TAAGACATATAGGCCGGGTGCGG + Intronic
975580567 4:75903318-75903340 TAACAAATTTAGGCCGGGTGTGG - Intergenic
975643734 4:76526075-76526097 AAATAAATGTCGGCCAGGTGCGG + Intronic
976297720 4:83488458-83488480 TTAAAAAATTAGGCCAGGTGCGG + Intronic
976349895 4:84049356-84049378 TCATAAATGTCAGCCAGATGCGG + Intergenic
976650971 4:87434332-87434354 AAACAAGTGTAGGCCAGGTGTGG - Intronic
976720807 4:88167072-88167094 TCAGAAGTCTAGGCTAGGTTAGG + Intronic
977138418 4:93335975-93335997 TAAGAAAGGAAGGACAGGTGTGG - Intronic
977266115 4:94856780-94856802 TTAGAAAACTATGCCAGGTGAGG + Intronic
977309598 4:95369258-95369280 TCAAAAAGTAAGGCCAGGTGTGG + Intronic
977602755 4:98951654-98951676 TAAAAAAAGTAGGCCAGGCGTGG - Intergenic
977801732 4:101242639-101242661 TAAGAAATCTGGGCCAGGTGTGG + Intronic
977895983 4:102365726-102365748 TTAAAAATGTAGGCTGGGTGCGG - Intronic
977958352 4:103056092-103056114 TCTGCATTATAGGCCAGGTGCGG - Intronic
978560415 4:110028004-110028026 TAAAACATGTAGGCCAGGCGCGG - Intergenic
978572561 4:110154543-110154565 TAATAAAAATAGGCCAGGTGTGG - Intronic
978581377 4:110235141-110235163 TAAAAAATGGTGGCCAGGTGCGG - Intergenic
978756902 4:112312560-112312582 TTAAGAATCTAGGCCAGGTGCGG - Intronic
979280035 4:118856797-118856819 TTAAAAATATAGGCCAGGTGTGG - Intronic
979579118 4:122334971-122334993 TCAGAAATGTAGGCACAGTTTGG + Intronic
979752788 4:124300182-124300204 AGAAAAATATAGGCCAGGTGCGG + Intergenic
980105572 4:128585199-128585221 TTAGAAATGCCGGCCGGGTGTGG + Intergenic
980364171 4:131777428-131777450 TCAAAAATAGAGGCCAGGCGTGG + Intergenic
980502181 4:133670354-133670376 TCATAATTCTAGGCCAGGCGCGG - Intergenic
980908511 4:138972667-138972689 CCAGAAATGGAGGCCAAGTGTGG - Intergenic
980933571 4:139205012-139205034 TAAAAAATGTAGGCAGGGTGCGG + Intergenic
981196122 4:141922812-141922834 CAAAAATTGTAGGCCAGGTGCGG + Intergenic
981288586 4:143047706-143047728 AAATAAATGTAGGCCAGGCGCGG + Intergenic
981311107 4:143298990-143299012 AAAGAAAGGCAGGCCAGGTGTGG + Intergenic
981334591 4:143555969-143555991 AACAAAATGTAGGCCAGGTGTGG - Exonic
981712459 4:147722797-147722819 TGAGAAATCCAGGCCAGGTGTGG + Intergenic
981738914 4:147982689-147982711 TAAGAAATCCAGGCTAGGTGTGG - Intronic
982385749 4:154800059-154800081 AGCTAAATGTAGGCCAGGTGCGG - Intronic
982436382 4:155385905-155385927 TAAGAAATTTAGGCTGGGTGTGG + Intergenic
982541911 4:156682935-156682957 TCAAGATTCTAGGCCAGGTGTGG - Intergenic
982874404 4:160627140-160627162 TCAGACATGGGGGCCTGGTGGGG + Intergenic
983206089 4:164911566-164911588 TGGGATATGTTGGCCAGGTGCGG + Intergenic
983635592 4:169895020-169895042 ACAAAAATATAGGCCAGGTGTGG + Intergenic
983906704 4:173190870-173190892 TCAGAAATGTAGAGGAGGCGTGG + Intronic
984155497 4:176191382-176191404 TTAGAAATCTAGGCCGGGTGCGG - Intronic
984325668 4:178247368-178247390 ATAGATATGTAGGCCAGGCGCGG - Intergenic
984373831 4:178901139-178901161 TAAGAAATGGAGGCCGGGCGCGG + Intergenic
984374635 4:178911965-178911987 AAGGAAAGGTAGGCCAGGTGCGG + Intergenic
984607732 4:181804717-181804739 TCAGAAGTGGATGCCTGGTGTGG + Intergenic
984645691 4:182217309-182217331 GGTGAAATTTAGGCCAGGTGCGG - Intronic
985857081 5:2436831-2436853 TCTGAAATTTAGGCCGGGCGCGG - Intergenic
986475179 5:8122616-8122638 TTAGAATTTTAGGCCAGGGGTGG + Intergenic
986888122 5:12265788-12265810 TCAGAAATGAGGGCCAGGTTAGG - Intergenic
987094549 5:14536568-14536590 ACAAGAATCTAGGCCAGGTGTGG + Intergenic
987749261 5:22018779-22018801 TCAGAAATGTTGGCCAGGCACGG + Intronic
987867918 5:23570902-23570924 CAAGAAATTTAGGCCAGGTGTGG + Intergenic
987928311 5:24370021-24370043 GCAGAAAAGTAGTACAGGTGTGG - Intergenic
987945934 5:24608579-24608601 TTCAGAATGTAGGCCAGGTGCGG - Intronic
987982473 5:25104246-25104268 TTTTAAAAGTAGGCCAGGTGCGG + Intergenic
988059178 5:26145244-26145266 AAAGAAAAGTAGGCCAGGCGCGG + Intergenic
989013284 5:36898797-36898819 TCAGAAAAACATGCCAGGTGTGG - Intronic
989174440 5:38508872-38508894 AAAGAAATTTAGGCCGGGTGTGG - Intronic
989387681 5:40869435-40869457 ATAGAATGGTAGGCCAGGTGTGG - Intergenic
989402265 5:41021585-41021607 ACAGACATATAGGCCAGGTATGG + Intronic
990452285 5:55946523-55946545 GGAAAAAGGTAGGCCAGGTGTGG + Intronic
990574119 5:57108438-57108460 TAAGAATTTTAGGCCAGGTGCGG + Intergenic
990581075 5:57168141-57168163 TTAGAAAAGTAGGCCAGGAACGG + Intergenic
990759063 5:59108601-59108623 TAAAAAATATTGGCCAGGTGCGG + Intronic
990793645 5:59514393-59514415 TGAAAAATGAAGGCCGGGTGCGG - Intronic
991252661 5:64580921-64580943 TAAAAACTGGAGGCCAGGTGTGG + Intronic
991335518 5:65542346-65542368 TCAAATCTTTAGGCCAGGTGTGG + Intronic
991473078 5:66990338-66990360 TCAGAAATATAGTCTAGGTTGGG + Intronic
991483816 5:67113021-67113043 ACAGGGATGAAGGCCAGGTGTGG + Intronic
991677398 5:69101565-69101587 TCTTATATGTAGGCCAGGCGTGG - Intronic
991925540 5:71701991-71702013 TGAGAAATGTCGGCTGGGTGCGG + Intergenic
992000563 5:72432223-72432245 GTAGAAATACAGGCCAGGTGCGG - Intergenic
992052139 5:72951038-72951060 TTACAAATATGGGCCAGGTGTGG - Intergenic
992361134 5:76039463-76039485 AAAGAAATTGAGGCCAGGTGTGG + Intergenic
992470870 5:77052060-77052082 TAAGAATTTTTGGCCAGGTGTGG + Intronic
992635654 5:78723717-78723739 TCAGAAATCTAGGCCAGGCACGG + Intronic
992643327 5:78788920-78788942 ACAAAAATGTAGGCCAGGTGTGG - Intronic
992794344 5:80242325-80242347 TTAGAAAAATAGGTCAGGTGTGG + Intronic
992927167 5:81600270-81600292 TCAGAAAATAAGGCCGGGTGTGG + Intronic
993077679 5:83254794-83254816 TGAAAAATGTAGACCAGGCGCGG + Intronic
993273161 5:85820767-85820789 TAAGAAATCTAGGCCGGGAGCGG - Intergenic
993528723 5:88999478-88999500 TAAGAGTTATAGGCCAGGTGTGG - Intergenic
993614568 5:90095768-90095790 TCAGAACTGTACCACAGGTGTGG - Intergenic
993994646 5:94708349-94708371 TCAGAAATTTAGCCCACCTGGGG - Intronic
994508697 5:100675371-100675393 TAAGAAAAACAGGCCAGGTGGGG - Intergenic
994761688 5:103862228-103862250 TCATAAAAGTTGGCCAGGCGTGG + Intergenic
994930002 5:106169868-106169890 TAAGAAATGAAGGCCAGGCATGG - Intergenic
995003792 5:107166508-107166530 TAAGAAATGTCGGCCGGGCGCGG + Intergenic
995514488 5:112940294-112940316 ACATAAAAGTTGGCCAGGTGTGG - Intergenic
996174582 5:120339626-120339648 ACAGTAAAATAGGCCAGGTGCGG - Intergenic
996441184 5:123492682-123492704 GCAGAAAAGGAGACCAGGTGCGG + Intergenic
996485251 5:124026359-124026381 TTAGAAAATTAGGCCAGGCGCGG + Intergenic
997163242 5:131631784-131631806 ACAAAAAGGTAGGCCAGGCGTGG + Intronic
997441524 5:133911984-133912006 AATAAAATGTAGGCCAGGTGCGG + Intergenic
997534894 5:134611871-134611893 AAAGAAAAGTAGGCCAGATGTGG + Intronic
997540457 5:134657337-134657359 ATAGAAATGTAGGCCAGGCACGG - Intronic
997541696 5:134668433-134668455 ACAGAAATTAAGGCCAGGTGCGG + Intronic
997862910 5:137434789-137434811 TAAGAAATGGAGGCCGGGCGTGG - Intronic
997915774 5:137923303-137923325 TTTTAAAAGTAGGCCAGGTGCGG - Intronic
997919599 5:137966144-137966166 TCCAAAATATAGGCCGGGTGTGG + Intronic
998023425 5:138791326-138791348 TAAAAAATGTCGGCCGGGTGCGG + Intronic
998066287 5:139161724-139161746 TTAGAATTGCTGGCCAGGTGCGG + Intronic
998066819 5:139165951-139165973 TAAGAAATACAGGCCAGGCGTGG - Intronic
998235310 5:140393542-140393564 TTAAAAATTTGGGCCAGGTGTGG + Intergenic
998534559 5:142917327-142917349 TCTGAAGTTTAGGCCAGGTGTGG - Intronic
998546793 5:143035643-143035665 TTATCCATGTAGGCCAGGTGCGG + Intronic
998835858 5:146202235-146202257 TTAAAAATGTAGGCCAGGCTGGG - Intergenic
998868213 5:146526946-146526968 AAAGATATCTAGGCCAGGTGTGG - Intergenic
999023521 5:148197878-148197900 TAAGAAAAATAAGCCAGGTGCGG - Intergenic
999146106 5:149395990-149396012 TTAAAAATATGGGCCAGGTGTGG - Intronic
999264759 5:150259228-150259250 ATAAAAATTTAGGCCAGGTGCGG + Intronic
999297887 5:150471926-150471948 TTAGAAAATTAGGCCAGGTGTGG + Intergenic
999464030 5:151784050-151784072 TAAAAAATGTTGGCCAGGTGTGG - Intronic
999734782 5:154505003-154505025 TCTTAATTGTAGGCCGGGTGCGG - Intergenic
999764220 5:154726128-154726150 CTTGAAATGTTGGCCAGGTGCGG - Intronic
1000350818 5:160351038-160351060 TTAGCACTGTGGGCCAGGTGTGG - Intronic
1000355675 5:160392070-160392092 CTAGATGTGTAGGCCAGGTGCGG - Intergenic
1000448883 5:161359790-161359812 TAAAAAATGGAGGCCGGGTGCGG + Intronic
1000557951 5:162750531-162750553 TAAGGCATGCAGGCCAGGTGTGG + Intergenic
1000567394 5:162866969-162866991 TTAGAAAGGTAGGCCGGGCGTGG + Intergenic
1001190437 5:169625860-169625882 TAAGAAATCACGGCCAGGTGTGG + Intergenic
1001578507 5:172781423-172781445 GTGGAAATCTAGGCCAGGTGTGG - Intergenic
1001614711 5:173033351-173033373 TTATAAATTTAGGCCAGGCGTGG - Intronic
1002007196 5:176245009-176245031 TAAGAAATGTTGGCCGGGTGCGG - Intronic
1002219184 5:177665613-177665635 TAAGAAATGTTGGCCGGGTGCGG + Intergenic
1002386724 5:178873076-178873098 TAAGAAACACAGGCCAGGTGTGG - Intronic
1002463985 5:179395004-179395026 TAATAGATGTAGGCCAGGCGTGG + Intergenic
1002527538 5:179823176-179823198 ACAGAGACATAGGCCAGGTGTGG + Intronic
1002620198 5:180482757-180482779 CCTGAAATATGGGCCAGGTGCGG - Intergenic
1002625484 5:180525244-180525266 TTTGAAAAGTAGGCCGGGTGCGG + Intronic
1002768348 6:263989-264011 TGAAAAAAATAGGCCAGGTGCGG - Intergenic
1002954019 6:1843925-1843947 TCAGAAATGCAGGAGAGCTGTGG + Intronic
1003231247 6:4255668-4255690 TAAGAAATGTGGGCCAGGCATGG + Intergenic
1003234334 6:4282341-4282363 TGAAAAATGTATGCAAGGTGTGG + Intergenic
1003353544 6:5343500-5343522 ACTGAAATGTAGGCCAGGCGCGG - Intronic
1003384215 6:5652529-5652551 GCAGAAATGAAGGCCCAGTGCGG + Intronic
1003671256 6:8162447-8162469 TAAGAAATTTAGGCCAGGCGTGG - Intergenic
1003687409 6:8317996-8318018 TCCAAAAAGTTGGCCAGGTGTGG + Intergenic
1003697888 6:8430587-8430609 AAAAAAATGAAGGCCAGGTGTGG + Intronic
1003701686 6:8472858-8472880 TCATCAATGGAGGCCAGGTGTGG - Intergenic
1003771435 6:9306657-9306679 TAAGAAATCCTGGCCAGGTGTGG + Intergenic
1003943740 6:11054241-11054263 TAATAAGTGTAGGCCAGGTGCGG + Intergenic
1004383940 6:15155921-15155943 ACAGAAATATGGGCCAGGCGCGG - Intergenic
1004509732 6:16275765-16275787 TCAGAAATATGGGCCTGATGTGG + Intronic
1004553800 6:16675588-16675610 TTAAAATTGGAGGCCAGGTGCGG + Intronic
1004649280 6:17593005-17593027 TTAGAAATGTGGGCCAGGTGTGG - Intergenic
1004936744 6:20515329-20515351 TCAGTAAATTAGGCCAGGCGTGG - Intergenic
1004937065 6:20518267-20518289 TAAGAAAAGTAGGCCAGGCGTGG + Intergenic
1005022931 6:21434794-21434816 CCAAAAATGTCAGCCAGGTGAGG + Intergenic
1005093162 6:22080594-22080616 TGAGAAATTTAGGCCAGGCACGG - Intergenic
1005126294 6:22450316-22450338 ACAGAAAAGTTAGCCAGGTGTGG - Intergenic
1005830295 6:29665384-29665406 TCACAAATATTGGCCAGGTGCGG - Intronic
1005847020 6:29789840-29789862 TAATTAATTTAGGCCAGGTGTGG - Intergenic
1005847095 6:29790491-29790513 TCAGAAATCTGGGCAAGATGTGG - Intergenic
1005866267 6:29939864-29939886 TAATTAATTTAGGCCAGGTGTGG - Intergenic
1005866400 6:29940824-29940846 TCAGAAATCTGGGCAAGATGTGG - Intergenic
1005945689 6:30593831-30593853 GCAAAAGTATAGGCCAGGTGCGG - Intronic
1005950864 6:30630338-30630360 ACAGAAAAAAAGGCCAGGTGCGG + Intronic
1006193958 6:32226174-32226196 TAAAAATTGAAGGCCAGGTGTGG - Intergenic
1006531619 6:34660007-34660029 TAAGAAAACCAGGCCAGGTGTGG + Intronic
1006534944 6:34691502-34691524 TAACAAATAGAGGCCAGGTGCGG + Intronic
1006622515 6:35375841-35375863 ACAGAAATAAAGGCCAGGTAAGG - Intronic
1006779100 6:36619963-36619985 ACAAAAATTAAGGCCAGGTGTGG + Intergenic
1007042088 6:38732004-38732026 AAAGAAATGTAGGCTGGGTGTGG - Intronic
1007117639 6:39354886-39354908 TAAAAAATGTTGGCCAGGTGTGG + Intronic
1007379606 6:41479583-41479605 TAAGAAAGTGAGGCCAGGTGCGG + Intergenic
1007486094 6:42181760-42181782 TCAGGAGTGGAAGCCAGGTGTGG + Intergenic
1007544459 6:42681916-42681938 TCTTAAAAGTAGGCCAGGTGTGG + Intronic
1007587214 6:42998742-42998764 ACAGAAAAGTAGGCCAGGCACGG + Intronic
1007671331 6:43556836-43556858 AAAGAAATGAAGGCCGGGTGTGG + Intronic
1007808315 6:44467735-44467757 TTAAAAATTTAGGCCAGGTGTGG + Intergenic
1007870872 6:45036410-45036432 TCAGAAAAGTAGCCAAGGTGGGG + Intronic
1007882456 6:45182550-45182572 AAAGAAAGGCAGGCCAGGTGCGG - Intronic
1007898327 6:45385607-45385629 TCTTAAAAGCAGGCCAGGTGTGG + Intronic
1007963330 6:45981257-45981279 ACAGAAAATGAGGCCAGGTGCGG - Intronic
1008505905 6:52229626-52229648 TAGAAAATGTAGGCCAGGTGTGG + Intergenic
1008655143 6:53604429-53604451 TAAAAAATAAAGGCCAGGTGCGG - Intronic
1008911660 6:56740156-56740178 TTAAGAAAGTAGGCCAGGTGCGG - Intronic
1008999645 6:57698967-57698989 AAAGAAATGGAGGCCAGCTGTGG - Intergenic
1009188132 6:60598389-60598411 AAAGAAATGGAGGCCAGCTGTGG - Intergenic
1009234190 6:61103080-61103102 TAAAAAATTTGGGCCAGGTGCGG + Intergenic
1009338187 6:62520585-62520607 TAAAAAATTTAGGCCAGCTGCGG + Intergenic
1009372395 6:62922335-62922357 ATAGAAATGTAGGCCAGGTATGG - Intergenic
1009394486 6:63182550-63182572 TTAGCATTATAGGCCAGGTGCGG - Intergenic
1009417244 6:63429443-63429465 CAAGAAATCTGGGCCAGGTGTGG + Intergenic
1009726783 6:67544842-67544864 TCAGAGATGAAGGCAAGATGTGG + Intergenic
1010003456 6:70971107-70971129 ACTGAAGTGTAGGCCAGGCGTGG - Intergenic
1010034690 6:71311433-71311455 ACAAAAATCTAGGCCAGGCGTGG + Intergenic
1010138604 6:72585945-72585967 TAAGAATTTTGGGCCAGGTGTGG - Intergenic
1010236381 6:73578354-73578376 ATGGAAATGAAGGCCAGGTGAGG + Intergenic
1010792319 6:80078575-80078597 TCAGAAAATTAGGGCAGGTATGG + Intergenic
1010881488 6:81178929-81178951 AAAAAAATTTAGGCCAGGTGTGG + Intergenic
1012085687 6:94823599-94823621 TCATAAAAATAGGCCGGGTGTGG - Intergenic
1012963921 6:105652407-105652429 TTAAAAATTGAGGCCAGGTGTGG + Intergenic
1012964986 6:105664182-105664204 TTAGAAGTGGAGGTCAGGTGCGG - Intergenic
1013000823 6:106020453-106020475 ACATAAATGTAGGCCAGGCATGG - Intergenic
1013134309 6:107265649-107265671 TAAGAAAACTTGGCCAGGTGCGG + Intronic
1013136659 6:107289080-107289102 TAAGAAATGGAGGCCGGGCGTGG + Intronic
1013209967 6:107977888-107977910 AAAAAAATGGAGGCCAGGTGTGG - Intergenic
1013257698 6:108405635-108405657 TCATTAAAATAGGCCAGGTGTGG - Intronic
1013274106 6:108567754-108567776 AAAGAAAACTAGGCCAGGTGCGG + Intronic
1013490119 6:110638202-110638224 CAAGACATGCAGGCCAGGTGTGG + Intronic
1013514078 6:110869797-110869819 TAGAAACTGTAGGCCAGGTGTGG - Intronic
1013517654 6:110903049-110903071 ACAGAAGTCTAGGCCAGGCGTGG - Intergenic
1013657893 6:112264463-112264485 TCAGAAATGTAGGAGCTGTGGGG + Intergenic
1013764067 6:113553658-113553680 TAATATATGCAGGCCAGGTGCGG - Intergenic
1013989297 6:116234629-116234651 TTAAAAATGTAGGCTGGGTGTGG - Intronic
1014438798 6:121450029-121450051 TTTTAAATATAGGCCAGGTGCGG - Intergenic
1014743500 6:125172441-125172463 ACAAAAATCCAGGCCAGGTGTGG - Intronic
1014743968 6:125178330-125178352 TAAAAAACATAGGCCAGGTGTGG + Intronic
1014744421 6:125183185-125183207 TTAGAAATGGAGACCAGGTGTGG + Intronic
1015226355 6:130861579-130861601 TCAAAAATGTTGGCCAGGTGTGG + Intronic
1015275447 6:131378999-131379021 GGAGATAGGTAGGCCAGGTGCGG - Intergenic
1015292289 6:131551065-131551087 TTAAAAACGTAGGCCAAGTGTGG + Intergenic
1015583093 6:134747756-134747778 TAAAAAATAGAGGCCAGGTGTGG + Intergenic
1015620538 6:135127369-135127391 AAAGAAATTTAGGCCAGGTGCGG + Intergenic
1015666809 6:135639988-135640010 TCAGATATTGATGCCAGGTGAGG - Intergenic
1015720634 6:136237519-136237541 TTAAAAATGTGGGCCAGGTGTGG + Intronic
1015958075 6:138619045-138619067 TGAAAAATGTTGGCCAGGTGCGG + Intronic
1015963648 6:138675822-138675844 TAAGAATTTTAGGCCAGGTGCGG - Intronic
1016483870 6:144513260-144513282 TTAAAAATATGGGCCAGGTGTGG + Intronic
1016484910 6:144527088-144527110 GCATAAATCTTGGCCAGGTGTGG - Intronic
1017156519 6:151327103-151327125 AAAAAAATGTAGGCCAGGTGCGG - Intronic
1017168115 6:151428822-151428844 TTATAAGTGTGGGCCAGGTGTGG - Intronic
1017334449 6:153238994-153239016 TAAGAAGTTCAGGCCAGGTGTGG + Intergenic
1017375954 6:153767984-153768006 TCTGAAATGTCGGCCAGGAGCGG - Intergenic
1017465628 6:154691213-154691235 TCTGAATTGTCAGCCAGGTGCGG + Intergenic
1017469485 6:154725393-154725415 AAAGAAATCCAGGCCAGGTGTGG + Intergenic
1017732292 6:157327476-157327498 TCAAAAATATAGGCCATGTGTGG + Intergenic
1017905219 6:158753370-158753392 TAAGAAATTTAGGCCTGGCGTGG - Intronic
1018277313 6:162146791-162146813 AAAAGAATGTAGGCCAGGTGTGG - Intronic
1018289665 6:162279038-162279060 TCAGAAATGTTGGCGAGGTGAGG + Intronic
1018322946 6:162633142-162633164 AAAAAAATGTAGGCCGGGTGCGG + Intronic
1019259799 7:75241-75263 ACAGAGATGTAGGCCAGGCACGG + Intergenic
1019455739 7:1126386-1126408 ATAAAAATGCAGGCCAGGTGCGG + Intronic
1019684601 7:2374035-2374057 TGAGAAGTGAAGGCCAGCTGGGG - Intronic
1020158003 7:5742970-5742992 TAAAAAACGTAGGCCAGGCGTGG + Intronic
1020253863 7:6490678-6490700 AAAGAAATTTAGGCCGGGTGCGG - Intergenic
1020560145 7:9721157-9721179 ACAGTTATGTAGGCCAGGCGCGG + Intergenic
1020762584 7:12286638-12286660 TAAGAAATGTTGGGCGGGTGCGG - Intergenic
1020965570 7:14863807-14863829 TTAAAAATGGAGGCCGGGTGTGG + Intronic
1021034131 7:15775439-15775461 GCAAAAATGTAGGCCAGGCAAGG - Intergenic
1021228442 7:18056464-18056486 TAAAAAAAATAGGCCAGGTGTGG - Intergenic
1021449043 7:20764582-20764604 TTACATGTGTAGGCCAGGTGTGG - Intronic
1021454035 7:20810274-20810296 TCATACATGTATGCCAGGTGTGG - Intergenic
1021488424 7:21192298-21192320 TTAGAATAATAGGCCAGGTGCGG + Intergenic
1021553424 7:21896017-21896039 TCAAAAGTGTGGGCCAGGCGCGG - Intronic
1021808580 7:24380428-24380450 TCATAAATGAAGCCCAAGTGAGG - Intergenic
1021890985 7:25186132-25186154 TTAAAAATGTTGGCCAGGCGTGG - Intergenic
1021987347 7:26109776-26109798 GAAAAAATTTAGGCCAGGTGTGG + Intergenic
1022009885 7:26299712-26299734 ATAGAAATATAGGCCAGATGCGG - Intronic
1022110961 7:27231268-27231290 ACAAAAATTTAGGCCAGGCGCGG + Intergenic
1022345008 7:29506164-29506186 TAAGAAATATAGGCCAGGCACGG + Intronic
1022687925 7:32613997-32614019 AGAGAAATATAGGCCAGGCGCGG + Intergenic
1023013342 7:35942452-35942474 TCAGTGTTGTTGGCCAGGTGCGG - Intergenic
1023262343 7:38370544-38370566 GCAGAACTGTACACCAGGTGAGG - Intergenic
1023438789 7:40165823-40165845 TAACAATTGCAGGCCAGGTGTGG + Intronic
1023443704 7:40210334-40210356 AAAGAAAAGTAGGCCAGGCGTGG - Intronic
1023708421 7:42966200-42966222 TGAAAAATGAAGGCCAGGTGTGG - Intergenic
1023893643 7:44413760-44413782 TTAGAAATACAGGCCGGGTGTGG + Intronic
1024002112 7:45196946-45196968 AAAAAAATGGAGGCCAGGTGCGG + Intergenic
1024077789 7:45831380-45831402 TCAGTGTTGTTGGCCAGGTGCGG + Intergenic
1024200501 7:47101632-47101654 ACACAGATGCAGGCCAGGTGAGG + Intergenic
1024297818 7:47859916-47859938 TCAGAAAAATAGGCTGGGTGTGG - Intronic
1024454391 7:49586706-49586728 TCCTAAATTTGGGCCAGGTGCGG + Intergenic
1024684322 7:51728923-51728945 TCAGGAATTTATACCAGGTGCGG + Intergenic
1024957625 7:54941303-54941325 TTAGAAAATGAGGCCAGGTGTGG + Intergenic
1025608021 7:63053534-63053556 TAAAAAATTTAGGCCAGGTATGG + Intergenic
1025678155 7:63659990-63660012 ACAGGAGTGTAGGCCAGGCGTGG - Intergenic
1025835449 7:65089065-65089087 TACAAAATGTGGGCCAGGTGTGG - Intergenic
1025905225 7:65778544-65778566 TACAAAATGTGGGCCAGGTGTGG - Intergenic
1025972899 7:66344699-66344721 TTAGAAATGTTGGCTGGGTGAGG - Intronic
1026039004 7:66850740-66850762 ACAAAAACATAGGCCAGGTGTGG - Intergenic
1026197910 7:68188866-68188888 TTAAAAATATAGGCCAGGCGAGG + Intergenic
1026466897 7:70662064-70662086 CCAGAGATGTGGGCCAGGTGGGG + Intronic
1026713816 7:72768495-72768517 TCAAACCTGTAGGCCAGGCGCGG + Intronic
1026804225 7:73419639-73419661 TTAGAAAATTAGGCCACGTGCGG - Intergenic
1026819035 7:73534411-73534433 ACAAAAATGTAGGCCGGGCGTGG - Intergenic
1027048224 7:75005155-75005177 ACATAAATTTAGGCCGGGTGCGG - Intronic
1027670561 7:81091701-81091723 CCAAAAATACAGGCCAGGTGTGG - Intergenic
1029080240 7:97967700-97967722 TCAGAAAGTTTGGCCAGATGCGG + Intergenic
1029130331 7:98325385-98325407 TAATAATTGGAGGCCAGGTGTGG + Intronic
1029443717 7:100601705-100601727 TGTGAAGTGGAGGCCAGGTGTGG + Intergenic
1029533224 7:101139308-101139330 TCAGAAGCCTAGGCCAGGTGTGG + Intergenic
1029645964 7:101856023-101856045 TAAGAAAAATTGGCCAGGTGTGG + Intronic
1030148992 7:106383986-106384008 TCAAGAATGCTGGCCAGGTGCGG + Intergenic
1030201013 7:106904049-106904071 TCAGAAAAGTGGGCCTGGTGCGG - Intronic
1030424149 7:109351462-109351484 TAAAAAGTTTAGGCCAGGTGCGG + Intergenic
1031132340 7:117847243-117847265 GCAGAAAACTAGGCCGGGTGTGG + Intronic
1031177800 7:118374767-118374789 TTAGAAATATTGGCCGGGTGCGG + Intergenic
1031520678 7:122761702-122761724 TTAAAAATGTAGGCCAGGCATGG + Intronic
1032010236 7:128341878-128341900 TAAGAACTCTAGGCCAGGCGTGG + Intronic
1032049154 7:128635862-128635884 AAAGAAATGGAGGCCAGGCGTGG - Intergenic
1032071998 7:128813688-128813710 AAAGAATTCTAGGCCAGGTGCGG + Intronic
1032233102 7:130093514-130093536 ACAAAAATATAGGCCGGGTGTGG - Intronic
1032834051 7:135657081-135657103 TCAGAAAGCTTGGCCAGGAGCGG - Intergenic
1033052617 7:138020149-138020171 TCAAAAATGTCGGCCGGGCGTGG - Intronic
1033090626 7:138382529-138382551 ATAGTAATTTAGGCCAGGTGTGG + Intergenic
1033132994 7:138761342-138761364 ACACAAATTCAGGCCAGGTGCGG + Intronic
1033137151 7:138795051-138795073 TCAGAAATATTAGCCAGGCGTGG - Intronic
1033209243 7:139448284-139448306 GGAGAAATGTTGGCCAGGTGTGG - Intergenic
1033302104 7:140195712-140195734 TGAAGAATTTAGGCCAGGTGTGG - Intergenic
1033353433 7:140580970-140580992 TCAAAAGTATAGGCCAGGTGCGG + Intronic
1033391609 7:140934133-140934155 TCATAAATATAGGCTGGGTGTGG + Intergenic
1033714357 7:143984520-143984542 ACAAAAATGTAGGCCAGATGCGG + Intergenic
1034106497 7:148495128-148495150 TTAGAAATCCAGGCCAGGAGCGG + Intergenic
1034182943 7:149152547-149152569 AAAGAAATCTAGGCCAGGCGCGG - Intronic
1034250307 7:149685262-149685284 TCACACACGTAGGCCGGGTGTGG + Intergenic
1034253349 7:149710161-149710183 AAAAAAATTTAGGCCAGGTGTGG - Intergenic
1034428813 7:151029795-151029817 TTAGAAAGGATGGCCAGGTGAGG - Intronic
1034463692 7:151213052-151213074 TTAAAAATGCAGGCCAGGTGCGG - Intronic
1034575514 7:151993772-151993794 TTAAAAAAATAGGCCAGGTGTGG - Intronic
1034635911 7:152566974-152566996 TAACAACTGTAGGCCAGGCGAGG - Intergenic
1034920173 7:155073028-155073050 TAAGAATTGAGGGCCAGGTGCGG + Intronic
1036421981 8:8605219-8605241 TGAAAATTGTAAGCCAGGTGAGG - Intergenic
1036429133 8:8673747-8673769 TCATAAATATAGGCCAGGCACGG + Intergenic
1036519684 8:9479575-9479597 GAACAAATGTAGGCCAGGCGCGG + Intergenic
1036724502 8:11207877-11207899 ACAGAGATGTAGGCAAGGGGAGG + Intergenic
1036768210 8:11562410-11562432 CGAGAAATGGAGGCCAGGGGAGG + Intronic
1036974097 8:13390695-13390717 TAAGAAAAACAGGCCAGGTGTGG + Intronic
1037051562 8:14380561-14380583 TGTGCAATGTAGGCCAGGCGTGG + Intronic
1037088160 8:14879032-14879054 ACCTAATTGTAGGCCAGGTGTGG + Intronic
1037093764 8:14956326-14956348 AAATAAAAGTAGGCCAGGTGTGG - Intronic
1037136772 8:15471906-15471928 TTAGAACTGGGGGCCAGGTGTGG - Intronic
1037149261 8:15616285-15616307 TCAGAATATCAGGCCAGGTGTGG + Intronic
1037263001 8:17027948-17027970 TCAGAAATGAAGGCCATGACAGG + Intronic
1037270083 8:17117266-17117288 TGAGAAATAGTGGCCAGGTGTGG - Intronic
1037272839 8:17148162-17148184 TTAAAAATTTAGGCCAGGTATGG - Intergenic
1037846573 8:22288006-22288028 TTGCAAATGTAGGCCGGGTGCGG + Intronic
1037861656 8:22409670-22409692 CCATACAAGTAGGCCAGGTGCGG - Intronic
1037970039 8:23165155-23165177 TCAGAAATGTGAGCCAGGGCCGG + Intergenic
1038064376 8:23947556-23947578 ATAGAAAAATAGGCCAGGTGCGG - Intergenic
1038092906 8:24274440-24274462 TGAAAAAAGTAGGCCGGGTGCGG + Intergenic
1038279582 8:26151878-26151900 TCAGAAAGATTGGTCAGGTGTGG + Intergenic
1038423903 8:27452278-27452300 TGAGAATAGAAGGCCAGGTGTGG + Intronic
1038456901 8:27678895-27678917 AAATCAATGTAGGCCAGGTGTGG + Intergenic
1038553085 8:28486515-28486537 GAAGAAATGTAGCCCAGGCGCGG - Intronic
1038570875 8:28661587-28661609 TTATATATGTAGGCCAGGTGAGG + Intronic
1038592414 8:28851926-28851948 TCACTACTGGAGGCCAGGTGTGG + Intronic
1038618220 8:29115614-29115636 TAAGAATTTAAGGCCAGGTGTGG - Intronic
1038632261 8:29257043-29257065 AAGGAATTGTAGGCCAGGTGTGG - Intronic
1038992325 8:32881238-32881260 TCAGGTTTGCAGGCCAGGTGTGG - Intergenic
1039316163 8:36374972-36374994 TGAAAAATGTAGGCCGGGCGTGG + Intergenic
1039533254 8:38283811-38283833 TTAGAAAAACAGGCCAGGTGTGG + Intronic
1039778692 8:40762362-40762384 ACAGAGAAGAAGGCCAGGTGTGG + Intronic
1039833948 8:41240885-41240907 TAAGAAAAATAGGCCAGGTATGG + Intergenic
1039940720 8:42088334-42088356 TACAGAATGTAGGCCAGGTGTGG - Intergenic
1040430556 8:47337419-47337441 ACACAAATAAAGGCCAGGTGTGG - Intronic
1040510534 8:48089379-48089401 TTAAAAATTTAGGCCAGGTGAGG - Intergenic
1040678389 8:49780077-49780099 TAAGAGATATCGGCCAGGTGCGG + Intergenic
1040779702 8:51093295-51093317 GCAGAAATTTAGGCCTGGTGCGG - Intergenic
1041043586 8:53870820-53870842 TTAGCAATATAGGCCAGGTGCGG + Intronic
1041096078 8:54351534-54351556 TCAGAAATGAAGCTCAAGTGAGG - Intergenic
1041152297 8:54948015-54948037 GCAGAAATTAAGGCCAGGCGTGG + Intergenic
1041232562 8:55768552-55768574 AAAAAAATTTAGGCCAGGTGCGG + Intronic
1041431836 8:57790888-57790910 ACAAAAAAATAGGCCAGGTGTGG + Intergenic
1041508167 8:58624335-58624357 TCCTAACTCTAGGCCAGGTGTGG - Intronic
1041898026 8:62948486-62948508 TAAGAAATACTGGCCAGGTGCGG - Intronic
1042031629 8:64482529-64482551 GCAGAAATGGAGTCCAGGTCAGG - Intergenic
1042124312 8:65521858-65521880 TGAAATATGTTGGCCAGGTGCGG - Intergenic
1042298111 8:67243947-67243969 TGAAAAATGCAGGCCAGGCGTGG + Intronic
1042403303 8:68374203-68374225 AAAGAATTATAGGCCAGGTGTGG - Intronic
1042485961 8:69345983-69346005 ATAGAAAAATAGGCCAGGTGTGG + Intergenic
1042546690 8:69957420-69957442 ACAGACATCTAGGCCAGGCGCGG + Intergenic
1042599317 8:70482377-70482399 TCATAATTATAGGCCAGGCGCGG - Intergenic
1042659768 8:71141545-71141567 TGAAAATTGAAGGCCAGGTGTGG - Intergenic
1042745896 8:72105173-72105195 TAAAAATTGTAGGCCAGGTGTGG - Intronic
1043077800 8:75723641-75723663 TCAAAAATCTGGGCCAGGCGTGG - Intergenic
1043418110 8:80072018-80072040 TAAGAAATGTAGGCCGGGCGCGG + Intronic
1043449317 8:80350496-80350518 TCATTAATCTGGGCCAGGTGAGG - Intergenic
1043870480 8:85426291-85426313 TAAGAGAAGTAGGCCGGGTGTGG + Intronic
1044060763 8:87632054-87632076 ATAGAAAAATAGGCCAGGTGTGG - Intergenic
1044549635 8:93497153-93497175 TCAGTAAAGGAGGCCAGGCGTGG - Intergenic
1044590510 8:93909640-93909662 TGAAAAAACTAGGCCAGGTGCGG - Intronic
1044680048 8:94768701-94768723 TAAGATGTGTTGGCCAGGTGCGG + Intronic
1044720295 8:95139211-95139233 TTACAAATGTTGGCCGGGTGCGG + Intronic
1044745170 8:95364449-95364471 TTAGAAAAGGGGGCCAGGTGTGG - Intergenic
1044819623 8:96146823-96146845 AAAGAAATTTAGGACAGGTGAGG + Intronic
1044975090 8:97656707-97656729 CCAGGAATTGAGGCCAGGTGCGG + Intronic
1045089825 8:98730425-98730447 TAAGACATAAAGGCCAGGTGTGG + Intronic
1045159079 8:99516496-99516518 TTAAAAATGTAGGCCAGGCATGG + Intronic
1045296224 8:100873662-100873684 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1045499275 8:102732456-102732478 TTAAAAAAGTAGGCCAGGTGTGG + Intergenic
1045893374 8:107184477-107184499 AAAGAGATATAGGCCAGGTGCGG + Intergenic
1046261680 8:111776538-111776560 TCAGAAATGAAGACAAGGTATGG - Intergenic
1046753176 8:117946187-117946209 ACAGTAATCTAGGCCAGGCGCGG - Intronic
1046932172 8:119852643-119852665 GAAGAAATTTGGGCCAGGTGTGG - Intronic
1047158112 8:122344905-122344927 AGAGTAAAGTAGGCCAGGTGAGG - Intergenic
1047441254 8:124880436-124880458 TAGGAAATCTAGGCCAGATGGGG - Intergenic
1047448584 8:124942163-124942185 AAAGACATGGAGGCCAGGTGCGG + Intergenic
1047829021 8:128611653-128611675 TCAGAAAAGCTGGCCAGATGGGG - Intergenic
1048168195 8:132082066-132082088 ACAGTAATGGGGGCCAGGTGTGG + Intronic
1048566873 8:135609583-135609605 TCAAAAAGGTAGGCCCGGTGTGG - Intronic
1048874105 8:138823020-138823042 TCAAAAATGTGGGCCCAGTGGGG + Intronic
1048913087 8:139155201-139155223 TTGGAAAAGTAGGCCAGGTTGGG + Intergenic
1048942038 8:139408279-139408301 TCATAAGTATAGGCCGGGTGCGG + Intergenic
1049111257 8:140645271-140645293 GAAGTAATCTAGGCCAGGTGCGG - Intergenic
1049319414 8:141988037-141988059 TCTGAAGGGAAGGCCAGGTGCGG - Intergenic
1049625837 8:143620132-143620154 TAAGAAATGGAGGCCAGGCGTGG - Intergenic
1049946643 9:603662-603684 TAAAAAATGTAGGCCAGGCATGG + Intronic
1050097165 9:2078652-2078674 TTAAAAAAGGAGGCCAGGTGCGG + Intronic
1050737696 9:8782884-8782906 AAAGAAGTGTAGGCCAGGCGTGG - Intronic
1050747524 9:8894061-8894083 TAACCAATCTAGGCCAGGTGCGG + Intronic
1051191020 9:14513337-14513359 ACAGAAATGAAGGCCGGGTGTGG + Intergenic
1051270328 9:15349156-15349178 TCAGCTTTGCAGGCCAGGTGGGG - Intergenic
1051432377 9:16992998-16993020 TCAAAAATAAAGGCCGGGTGCGG - Intergenic
1051664402 9:19455300-19455322 TCTCAAATATAGGCCTGGTGCGG + Intergenic
1052230451 9:26144605-26144627 TTAAAAATGTAGGCCGGGCGTGG - Intergenic
1052911655 9:33887963-33887985 TTAGAATAGTAGGCCAGGCGCGG - Intronic
1053074866 9:35124220-35124242 TCAATAATGTAGTCCAGGCGCGG - Intergenic
1053079078 9:35159662-35159684 TCCTAATTCTAGGCCAGGTGCGG - Intergenic
1053124404 9:35567980-35568002 TAAAAAATCCAGGCCAGGTGCGG - Intergenic
1053491706 9:38511088-38511110 TTAGAAATCAGGGCCAGGTGCGG + Intergenic
1053586395 9:39463565-39463587 TCAGAATTTTTGGCCAGGCGCGG - Intergenic
1054579909 9:66901652-66901674 TCAGAATTTTTGGCCAGGTGCGG + Intronic
1054876254 9:70099677-70099699 TCAGAAAGGTAGGGCAGGCCAGG + Intronic
1055037204 9:71830507-71830529 TGAAATATGTAGGCCAGGCGTGG + Intergenic
1055104881 9:72501888-72501910 TCAGCAAGATAGGCCAGGTGTGG - Intergenic
1055249216 9:74282208-74282230 TAAGAAATGTAGGCTGGGCGCGG + Intergenic
1055292020 9:74792045-74792067 TCAGCAATTGAGGCCAGGCGTGG - Intronic
1055296972 9:74843516-74843538 TAAGAGTTGAAGGCCAGGTGCGG + Intronic
1055391284 9:75824780-75824802 TCAAAAATGTGGGCCACTTGGGG - Intergenic
1055515234 9:77026842-77026864 ATTGAAATTTAGGCCAGGTGCGG - Intergenic
1055529320 9:77168063-77168085 TAAGAAGACTAGGCCAGGTGTGG - Intergenic
1055596121 9:77866185-77866207 ACAAAAATTTAGGCCGGGTGTGG + Intronic
1055709808 9:79048620-79048642 TTACATATGTAAGCCAGGTGTGG + Intergenic
1055898745 9:81210685-81210707 TAAGAAATGTAGGCCAGGCACGG + Intergenic
1055952899 9:81747159-81747181 GGAAAAATGTAGGCCAGGCGTGG + Intergenic
1056000621 9:82212588-82212610 TAAGAAATGTTGGCCAGGTATGG + Intergenic
1056176432 9:84041186-84041208 GAAAAAATGTTGGCCAGGTGTGG - Intergenic
1056300076 9:85231618-85231640 TAAGAAAAAGAGGCCAGGTGCGG + Intergenic
1056471016 9:86904527-86904549 ACCCAAAAGTAGGCCAGGTGTGG + Intergenic
1056828461 9:89892807-89892829 AAAGCAATGTAGGCCAGGCGCGG - Intergenic
1056942987 9:90971230-90971252 TAAAGAATGAAGGCCAGGTGTGG + Intergenic
1056943314 9:90973553-90973575 TATGAAAATTAGGCCAGGTGCGG - Intergenic
1056947164 9:91007907-91007929 TCAGAAATGGAGGTCAGGAGGGG + Intergenic
1057100085 9:92351198-92351220 ACAGAAACTTTGGCCAGGTGTGG + Intronic
1057117243 9:92537164-92537186 TAAGAATTTCAGGCCAGGTGCGG - Intronic
1057119366 9:92557931-92557953 TGCGAAATGCAGGCCAGGCGCGG - Intronic
1057156718 9:92848595-92848617 ACAGAAAATAAGGCCAGGTGCGG + Intronic
1057174437 9:92985766-92985788 ACAGAAAAATGGGCCAGGTGCGG - Intronic
1057286354 9:93757942-93757964 TCAGAAATGAAGCTCAGGTCTGG - Intergenic
1057581685 9:96292636-96292658 TCACAAATTTGGGCCCGGTGTGG - Intronic
1057640640 9:96817273-96817295 TGAGAAATTTAGGCCAGGTGTGG + Exonic
1057672003 9:97100292-97100314 TTAGAAATCAGGGCCAGGTGTGG + Intergenic
1057715403 9:97491220-97491242 ACAGAAATGTGGGCTGGGTGTGG - Intronic
1057964953 9:99493672-99493694 TCAGAGCTGGAGGACAGGTGGGG - Intergenic
1058217102 9:102248585-102248607 TCAGAAGTTTAGGCTGGGTGCGG + Intergenic
1058549125 9:106094286-106094308 TAAGAAATATAGGCCAGACGCGG + Intergenic
1058708144 9:107654497-107654519 AAAGAAAAATAGGCCAGGTGGGG - Intergenic
1058711743 9:107685010-107685032 TAAGATATTGAGGCCAGGTGCGG + Intergenic
1058715687 9:107720201-107720223 TCAGAATAGCAGGCCGGGTGCGG - Intergenic
1058861586 9:109122006-109122028 AGGCAAATGTAGGCCAGGTGCGG - Intergenic
1058989103 9:110237984-110238006 ACACAAATATGGGCCAGGTGTGG + Intergenic
1059078482 9:111221078-111221100 GAAGAAATATAGGCCAGGTGCGG - Intergenic
1059122230 9:111651594-111651616 ACAGAATTGCAGGCTAGGTGCGG + Intronic
1059205634 9:112462171-112462193 ACAAAAATTTAGGCCAGGCGTGG + Intronic
1059222326 9:112635540-112635562 AGAGAAATGGAGGCCAGATGAGG - Intronic
1059355027 9:113692120-113692142 ACAGAAATGCAGGCCGGGCGTGG - Intergenic
1059645921 9:116267581-116267603 TAAGAAATGGCGGCCGGGTGCGG + Intronic
1059919673 9:119144671-119144693 TTAAAAATGTAGGCTGGGTGAGG - Intergenic
1060330152 9:122660773-122660795 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1060627290 9:125125240-125125262 TTAAAAATGAAGGCCAGGCGCGG + Intronic
1060673470 9:125491151-125491173 AAAAAAATTTAGGCCAGGTGCGG + Intronic
1060823683 9:126675434-126675456 TAAAAAATGTTGGCCGGGTGCGG + Intronic
1061157494 9:128873211-128873233 TTAAAAATGTAGCCCAGGTGTGG + Intronic
1061685601 9:132274734-132274756 TCAGACCTGTAGGCTGGGTGTGG - Intronic
1061745662 9:132738341-132738363 TAAGATACTTAGGCCAGGTGCGG - Intronic
1061772298 9:132935254-132935276 TCAGAAATGTAGACGGGGAGAGG - Intronic
1061809632 9:133154841-133154863 TCCTAAAGGAAGGCCAGGTGGGG + Intronic
1062006928 9:134243276-134243298 TCAGAAATATAGGCTGGGCGCGG + Intergenic
1062292358 9:135802148-135802170 TCAGAAATCTAAGCCGGGCGTGG - Intergenic
1062608942 9:137364329-137364351 TCATTAATTTAGGCCAGGTGCGG + Intronic
1062663433 9:137652879-137652901 ACAGAAAAGTTAGCCAGGTGTGG - Intronic
1062744898 9:138205218-138205240 ACAGAGATGTAGGCCAGGCACGG - Intergenic
1203368009 Un_KI270442v1:275158-275180 TCAGAAGTAAAGGCCGGGTGTGG + Intergenic
1185861966 X:3588339-3588361 TAACCAATGAAGGCCAGGTGCGG + Intergenic
1187051517 X:15701204-15701226 TAAGAAGTCTAGGCCGGGTGCGG + Intronic
1187434347 X:19253355-19253377 TAAAAAATGATGGCCAGGTGCGG + Intergenic
1187434997 X:19259599-19259621 TCACAAAAGTTAGCCAGGTGTGG + Intergenic
1187690589 X:21862513-21862535 TAAAAAATATAGGCCTGGTGCGG + Intronic
1187710562 X:22049402-22049424 TAAGAAAAGTTGGCCAGGCGCGG - Intronic
1187842251 X:23500732-23500754 AAAGAAAAGTTGGCCAGGTGCGG - Intergenic
1187880935 X:23846712-23846734 TCAGAGATGAAGGCCAGTTGTGG - Intronic
1187901222 X:24028295-24028317 TAAGAAATTGAGGCCAGGCGTGG + Intergenic
1188183297 X:27082520-27082542 ACAAAAATCTGGGCCAGGTGCGG - Intergenic
1188396095 X:29685694-29685716 ACAGAAGTATTGGCCAGGTGCGG + Intronic
1188660061 X:32748050-32748072 GAAAAAGTGTAGGCCAGGTGTGG + Intronic
1189067796 X:37829587-37829609 TCAGCAATGTAGGCTGGGAGTGG - Intronic
1189465436 X:41274878-41274900 TGACCAATGTAGGCCAGGTGTGG - Intergenic
1189476408 X:41359680-41359702 TTAAAAAAGTGGGCCAGGTGTGG + Intronic
1189997622 X:46654098-46654120 TTAATCATGTAGGCCAGGTGTGG + Intronic
1190041197 X:47073737-47073759 TTAAAAATCTGGGCCAGGTGTGG + Intergenic
1190177888 X:48166750-48166772 TAAAAACTGAAGGCCAGGTGTGG - Intergenic
1190197014 X:48328537-48328559 TAAAAACTGAAGGCCAGGTGCGG - Intergenic
1190378908 X:49818811-49818833 AAAGAAAAGTTGGCCAGGTGTGG + Intergenic
1190379804 X:49828840-49828862 ACAAAAATCCAGGCCAGGTGCGG - Intergenic
1190585377 X:51934821-51934843 TGAGAAGTGTCAGCCAGGTGTGG + Intergenic
1190658534 X:52634348-52634370 TAAAAACTGGAGGCCAGGTGCGG - Intergenic
1190663748 X:52678916-52678938 TAAAAACTGGAGGCCAGGTGCGG - Intronic
1190675675 X:52779506-52779528 TAAAAACTGGAGGCCAGGTGCGG + Intronic
1190704395 X:53014470-53014492 TAAGACCTTTAGGCCAGGTGTGG + Intergenic
1190710567 X:53065807-53065829 TAACAAATGCAGGCCAGGTGCGG + Intronic
1190754746 X:53391773-53391795 AAATAAATGTTGGCCAGGTGTGG - Intronic
1190823771 X:53998161-53998183 AAAGAAAGGCAGGCCAGGTGTGG + Intronic
1190829574 X:54047897-54047919 TCAAAAGTGTTGGCCGGGTGTGG + Intronic
1190851319 X:54245194-54245216 TTAAAAATACAGGCCAGGTGTGG + Intronic
1191995471 X:67090726-67090748 ACAGAAATGTAGGCCAGGTCTGG + Intergenic
1192109649 X:68351215-68351237 TCAGAAAAATAGGCCAGGTGTGG - Intronic
1192245837 X:69370760-69370782 TAAGAAATTTAGGCCGGGCGCGG - Intergenic
1192327067 X:70142040-70142062 AGAGAAGAGTAGGCCAGGTGTGG + Intronic
1192435782 X:71142868-71142890 TAAGAAATTTAGGCCGGGCGCGG - Intergenic
1192468557 X:71376377-71376399 TCAGAAAGTAGGGCCAGGTGTGG + Intronic
1192605000 X:72507137-72507159 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1192740067 X:73883379-73883401 TCAACAAAGAAGGCCAGGTGTGG + Intergenic
1192774793 X:74232327-74232349 TACAACATGTAGGCCAGGTGTGG + Intergenic
1192831614 X:74756249-74756271 TTAAAAATTTAGGCCAGGTGCGG - Intronic
1193144929 X:78066655-78066677 TTAAAAATCTAGGCCAGGTGTGG + Intronic
1193664290 X:84297302-84297324 ACTTTAATGTAGGCCAGGTGTGG + Intergenic
1193828518 X:86257696-86257718 CAAGAGTTGTAGGCCAGGTGTGG - Intronic
1194190349 X:90827627-90827649 TTAAAAATTTAGGCCTGGTGTGG - Intergenic
1194874531 X:99170540-99170562 TCAGAAAGGTGAGTCAGGTGAGG + Intergenic
1195507929 X:105680287-105680309 AAAGAAATTCAGGCCAGGTGCGG - Intronic
1195628498 X:107029411-107029433 TTCAACATGTAGGCCAGGTGCGG + Intergenic
1195780289 X:108454901-108454923 TCATAGAAGTAGGCCAGGCGTGG - Intronic
1196426885 X:115579061-115579083 TCAAAAATGGAGGTCAGGGGAGG - Intronic
1196647304 X:118131834-118131856 TCAAGAATCCAGGCCAGGTGCGG - Intergenic
1196651835 X:118175802-118175824 TAAGAAAAATAGGCCAGGTGTGG - Intergenic
1196678409 X:118445003-118445025 TGAGAAATTTGGGCCTGGTGCGG + Intronic
1196799213 X:119527228-119527250 TTAGAAAAGTTGGCCAGTTGCGG - Intergenic
1196801842 X:119551188-119551210 TTAAAAATGGGGGCCAGGTGCGG + Intronic
1197205940 X:123790599-123790621 ACAAAAATCTTGGCCAGGTGCGG - Intergenic
1197448846 X:126585684-126585706 TAGCAAATGTAGGTCAGGTGTGG + Intergenic
1197780725 X:130157674-130157696 TAAAAAATGTAGGTCAGGCGTGG + Intronic
1198307831 X:135400301-135400323 TAAAAAATCTAAGCCAGGTGAGG - Intergenic
1199353452 X:146832185-146832207 ACAGAAGTGCAAGCCAGGTGCGG + Intergenic
1199799584 X:151236344-151236366 ACAAAAATGTTAGCCAGGTGTGG - Intergenic
1200306690 X:155032565-155032587 TAAGAAATGAAGGCCAGGCATGG - Intronic
1200537004 Y:4410047-4410069 TTAAAAATTTAGGCCTGGTGTGG - Intergenic
1200600629 Y:5200740-5200762 TCATAAATATGAGCCAGGTGTGG - Intronic
1201287797 Y:12393845-12393867 TTAGGAATTTAGGCCAGGTGTGG - Intergenic
1201781588 Y:17729225-17729247 TCAGAATTGGAGGCCAGGGCTGG + Intergenic
1201819965 Y:18176765-18176787 TCAGAATTGGAGGCCAGGGCTGG - Intergenic
1201854852 Y:18529905-18529927 TCAGAAGTGGAGGCCAGGACTGG - Intergenic
1201878469 Y:18790480-18790502 TCAGAAGTGGAGGCCAGGACTGG + Intronic
1202098356 Y:21278148-21278170 TAAGAAATGCTGGCCAGGCGCGG - Intergenic
1202173077 Y:22072019-22072041 TCAGAATTGGAGGCCAGGGCTGG + Exonic
1202218283 Y:22514352-22514374 TCAGAATTGGAGGCCAGGGCTGG - Exonic
1202324903 Y:23681703-23681725 TCAGAATTGGAGGCCAGGGCTGG + Intergenic
1202360981 Y:24110175-24110197 TGAGAAATGTCGGCCGGGCGCGG + Intergenic
1202509797 Y:25559943-25559965 TGAGAAATGTCGGCCGGGCGCGG - Intergenic
1202545868 Y:25988351-25988373 TCAGAATTGGAGGCCAGGGCTGG - Intergenic
1202581369 Y:26384652-26384674 ACAGAAATCCAGGCCAGGCGCGG + Intergenic