ID: 1095245286

View in Genome Browser
Species Human (GRCh38)
Location 12:39912556-39912578
Sequence CAGTAGCCACAGATTAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095245281_1095245286 22 Left 1095245281 12:39912511-39912533 CCTAATATCCTAATATGGATAGA 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1095245286 12:39912556-39912578 CAGTAGCCACAGATTAGGGATGG 0: 1
1: 0
2: 1
3: 16
4: 169
1095245282_1095245286 14 Left 1095245282 12:39912519-39912541 CCTAATATGGATAGAAAAGTTAT 0: 1
1: 0
2: 1
3: 31
4: 283
Right 1095245286 12:39912556-39912578 CAGTAGCCACAGATTAGGGATGG 0: 1
1: 0
2: 1
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095245286 Original CRISPR CAGTAGCCACAGATTAGGGA TGG Intronic
900033462 1:387931-387953 CAGCAGGCCCAGATGAGGGAAGG + Intergenic
900054300 1:617820-617842 CAGCAGGCCCAGATGAGGGAAGG + Intergenic
900417949 1:2543627-2543649 CAGGAGCCACAGGCGAGGGAGGG - Intergenic
903738782 1:25546115-25546137 CAGTGGCCACAGGTTAGAGCAGG + Intronic
905369813 1:37476958-37476980 CAGGGGCCACAAATTAGGGAGGG - Intronic
911077887 1:93896607-93896629 CAGTGGGCACAGGTGAGGGATGG - Exonic
913003678 1:114607074-114607096 CAGTAGTCACTGAGTAGGGGTGG + Intronic
914349735 1:146830724-146830746 CAGTGGCCTGAGATAAGGGAAGG - Intergenic
915118705 1:153615560-153615582 CAGCAGCTACAGGTTGGGGAAGG + Intronic
915729826 1:158045290-158045312 CAGAATCCACAGGTTAGGTAAGG + Intronic
918623021 1:186626487-186626509 CAGGAGTCACAGATTTGGGAAGG + Intergenic
920697119 1:208189406-208189428 CAGGAGGCCCAGAATAGGGAGGG + Intronic
920727313 1:208448232-208448254 CTGTAGCCACTGAGTAGGAAAGG - Intergenic
921735592 1:218624017-218624039 CAGTAGCCATGAATTGGGGATGG - Intergenic
922193142 1:223337685-223337707 CAGTGGGCACAGGTGAGGGAGGG - Intronic
922255817 1:223892085-223892107 CAGCAGGCCCAGATGAGGGAAGG + Intergenic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
924337017 1:242994950-242994972 CAGCAGGCCCAGATGAGGGAAGG + Intergenic
1062853287 10:762524-762546 CAGTATCCACAGAATTGGGTAGG - Intergenic
1066179390 10:32944812-32944834 CAGTGCCCACAGTTTTGGGAGGG - Intronic
1067280882 10:44871760-44871782 CAGTAGGCACTGACTGGGGAGGG - Intergenic
1067989733 10:51198124-51198146 CAGTAGTCACAGTTTTGGGCAGG + Intronic
1073860639 10:107734128-107734150 CAGTGGCCACAGCTCTGGGAAGG - Intergenic
1079323862 11:19475069-19475091 CAGCAGCCACAGAGAAGGGGAGG + Intronic
1084525793 11:69697294-69697316 CATTTGCCAGGGATTAGGGATGG - Intergenic
1084657069 11:70525861-70525883 CAGGAGTCACAGAGCAGGGAGGG - Intronic
1086726797 11:90196248-90196270 CAGTTGACAAAAATTAGGGATGG - Intergenic
1090127422 11:124101984-124102006 CAGGAGCCACAGATGTTGGAAGG - Intergenic
1091972217 12:4797030-4797052 CAGTAGCCAGAGTCCAGGGAAGG - Intronic
1092913094 12:13165483-13165505 CAGCAGCCACAGTGTGGGGAAGG + Intergenic
1093671070 12:21876691-21876713 AAGTAGACACAGATGAGGGGAGG + Intronic
1095245286 12:39912556-39912578 CAGTAGCCACAGATTAGGGATGG + Intronic
1095837890 12:46658250-46658272 GAGTAGCCACAGATTGGGGGTGG - Intergenic
1096807996 12:54151958-54151980 AAGTAGCAACAGCTGAGGGAAGG + Intergenic
1097195173 12:57239065-57239087 CATTAGCCGCAGATTAGGCACGG + Intronic
1098306103 12:69104214-69104236 CATTAGCCACAGATTAGTCCAGG + Intergenic
1099009717 12:77277364-77277386 CAGTAGGCAATGATTAGGGATGG - Intergenic
1099112397 12:78577956-78577978 CAGTAGCCTCAAATTAAGAAAGG - Intergenic
1099897039 12:88661396-88661418 CAGGAGCCACGCACTAGGGAGGG + Intergenic
1100053777 12:90484340-90484362 GAGTAGGCACAGATAAGAGAGGG - Intergenic
1102076919 12:110067030-110067052 CAATGGCCACAGACTAGGGAAGG - Intronic
1104511235 12:129380730-129380752 CGGTTGCCAGGGATTAGGGATGG - Intronic
1105993669 13:25649338-25649360 CAGTAGCCTCAGATCAGGCCAGG + Intronic
1106128178 13:26918131-26918153 TAGTAGCCAGAGGTTAGGGAGGG - Intergenic
1109796708 13:67324219-67324241 CAGCAGCCGCACATTAAGGAAGG + Intergenic
1111742118 13:92217541-92217563 TTGTAGCCACAGATTGGAGATGG - Intronic
1113529059 13:111006686-111006708 CAGAAGTCACAGAATTGGGAAGG + Intergenic
1116969079 14:51046127-51046149 TAGTAGCCAGGGATTAGGGATGG + Intronic
1122935390 14:104953612-104953634 CAGAAGACACAGAGCAGGGAAGG - Exonic
1202848868 14_GL000225v1_random:3109-3131 CAGTAGCCAGAGCTTAGACAAGG + Intergenic
1125577652 15:40766393-40766415 CAGTAGTCACAGTTTAGACATGG - Exonic
1127706133 15:61548784-61548806 TATTAGCCAGAGATGAGGGAGGG - Intergenic
1129488550 15:75902048-75902070 CAGTAGCCAGAGAATGGAGAAGG + Intergenic
1130234499 15:82121631-82121653 AAGAAGCCACAGGTTGGGGAGGG + Intergenic
1130750572 15:86708030-86708052 CAGTAGCTACAGACTACAGAAGG - Intronic
1133159777 16:3903250-3903272 CAGTAGCCAGAGATGAGCAAAGG + Intergenic
1137270248 16:46898262-46898284 CAGGAGCTCCAGATTGGGGACGG + Intronic
1139201964 16:64986955-64986977 CAGTAGCTAAAGAGGAGGGAAGG - Intronic
1139244348 16:65427043-65427065 AAGTGGCCAGAGATTGGGGAAGG - Intergenic
1139403488 16:66699984-66700006 CACTAGGCACAGTTCAGGGAAGG + Intergenic
1139725147 16:68891764-68891786 CTGTAGCTACAGCTTAAGGAAGG + Intronic
1139984301 16:70884822-70884844 CAGTGGCCTGAGATAAGGGAAGG + Intronic
1140072023 16:71658884-71658906 CAGCAGCCACAGAGTACAGAAGG + Intronic
1140439765 16:74978588-74978610 CAGCTGCCAGAGATAAGGGATGG + Intronic
1141159216 16:81617916-81617938 CAGTGGACACAGAAGAGGGAGGG + Intronic
1146423821 17:32716388-32716410 TATTAGCCACAGACTAGGGAGGG - Intronic
1149080632 17:52652225-52652247 CAGTAGGTACAGTTTAAGGAGGG + Intergenic
1156478934 18:37424141-37424163 CAGGAACCACATATTAGAGAAGG - Intronic
1156880152 18:42067934-42067956 CAGTATCCACAGATAAGTGAGGG + Intronic
1159164348 18:64683162-64683184 CACTGGGCACAGACTAGGGAGGG - Intergenic
1159285681 18:66347162-66347184 CAGTAGCTACACATCATGGAAGG - Intergenic
1160625727 18:80203622-80203644 CAGCAACCACAGATGAGGCAAGG - Intronic
1166071463 19:40390422-40390444 CAGTAGCCACAGACTGGGACAGG - Intergenic
1166559974 19:43726243-43726265 AAGTAGCCACAGGTAAGGGGCGG + Intergenic
1168225842 19:54994477-54994499 CACTAGCCACAGATTCAGTAAGG - Intronic
927065119 2:19463272-19463294 CAGTAGCCAGAGGTCAAGGAAGG + Intergenic
927067380 2:19486937-19486959 CAGTAGCCACAGAATATGCCAGG + Intergenic
927570989 2:24159891-24159913 CAGCAGCCACAGAGAAAGGACGG - Intronic
928445223 2:31328079-31328101 CAATACCCAGAGAGTAGGGAGGG + Intergenic
929783687 2:44974055-44974077 CAGAAGCCCCAGATTAGGGAAGG + Intergenic
930190093 2:48449301-48449323 CAGTAGCCTCAGAAGAAGGAAGG + Intronic
930241794 2:48943049-48943071 CAGTTGCCAGGGGTTAGGGATGG - Intergenic
930683977 2:54288056-54288078 CTGTAGCCACAATTTAGAGAGGG + Intronic
933518412 2:83335960-83335982 TGGTTGCCAGAGATTAGGGATGG - Intergenic
934151914 2:89155167-89155189 CAGTAGCCACATATTACTAATGG - Intergenic
935013430 2:99156928-99156950 CAGTAAGCACAGAATAGAGATGG + Intronic
935659197 2:105450977-105450999 CAGAAGCCTTAGATAAGGGAAGG + Intergenic
937149058 2:119673469-119673491 CAGTGGGGACAGAGTAGGGAGGG - Intergenic
937927014 2:127175259-127175281 CTGTAGCAACTGATTACGGAGGG + Intergenic
937983737 2:127629351-127629373 CAGGAGCCAGGGATGAGGGAGGG - Intronic
938220619 2:129563608-129563630 CACAAGCCACAGAGTGGGGAAGG - Intergenic
938581913 2:132654144-132654166 CACTAGCCAAAGATGGGGGAAGG + Intronic
941936016 2:170981839-170981861 CATTGGGCACAGACTAGGGAGGG + Intergenic
944938983 2:204602511-204602533 TACTAACCACAGATTAGGAATGG - Intronic
946152017 2:217781749-217781771 TAGTGGCCATAGATTAAGGAGGG + Intergenic
946748105 2:222865652-222865674 GAGCAGGCACAGAGTAGGGAAGG + Intronic
947008190 2:225536433-225536455 TAGTGGCCACACATTATGGAAGG + Intronic
947466749 2:230357340-230357362 TAGCAGCTACAGATTAGAGAAGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170880030 20:20288964-20288986 ATGAAGCCACAGATTAGGTATGG + Intronic
1172641322 20:36442096-36442118 CTGGAGATACAGATTAGGGATGG - Intronic
1173847693 20:46198474-46198496 CAGTAGCTACAGAGGAGGGGAGG - Intronic
1174198726 20:48791994-48792016 CAGAAGGCACAGATTGGGGTTGG + Intronic
1176288667 21:5033037-5033059 CAGTGGCCACGGAGTAGGGGCGG + Intronic
1179868517 21:44230438-44230460 CAGTGGCCACGGAGTAGGGGCGG - Intronic
1180161810 21:46001584-46001606 CAGGCGCCCCAGATGAGGGAGGG + Intronic
1181701256 22:24622769-24622791 CTGTGGCCACAGATGAGAGAAGG + Intronic
1184433303 22:44454305-44454327 GAGGAGCCACAGCTCAGGGAGGG + Intergenic
1184971055 22:48020109-48020131 CAGGAGGCAGTGATTAGGGAGGG + Intergenic
949543879 3:5055476-5055498 CTGTAGCCACAGAAGAGGAAGGG - Intergenic
951913647 3:27776990-27777012 CAGAAGCCATAGAGTGGGGAGGG + Intergenic
953396685 3:42578394-42578416 CAGTTGTCAGAGGTTAGGGATGG + Intronic
954410917 3:50370529-50370551 CAGGAGCCAGAGAGAAGGGACGG + Intronic
956412773 3:68995560-68995582 CAGCAGCCACAGAGAAGGGGAGG + Intronic
959560313 3:107772239-107772261 CAGAAGCCACAGAGGAGTGAGGG + Intronic
963456934 3:145556170-145556192 CACTGGTCACAGACTAGGGAAGG - Intergenic
964402431 3:156313282-156313304 CAGTAGCCAAAAAATAGGGGTGG - Intronic
965599276 3:170439726-170439748 CAGTAGCCCCTGTTTAGGGTGGG + Intronic
966801535 3:183768626-183768648 CTGTAGCCACAGAGCAGGGCAGG - Intronic
969003922 4:4004406-4004428 CACTAGGAACAGACTAGGGAGGG + Intergenic
969810005 4:9640418-9640440 CACTAGGAACAGACTAGGGAGGG - Intergenic
972364303 4:38359976-38359998 CAATAGGCACAGAGTGGGGATGG - Intergenic
972811845 4:42597158-42597180 CAGTAGCCACACATTTAGAAAGG + Intronic
974487976 4:62528104-62528126 CATTAACCAGAGATAAGGGAGGG - Intergenic
975649169 4:76574803-76574825 CAGTTGCCACAGGTTGGGGGAGG + Intronic
978831718 4:113094047-113094069 CAAAAGCCACAGATTAAGGAAGG - Intronic
979240104 4:118440354-118440376 CAGCAGGCCCAGATGAGGGAAGG - Intergenic
980388656 4:132118900-132118922 CGCCAGCCACAGACTAGGGAAGG + Intergenic
983023616 4:162709904-162709926 CACCAGTCACAGACTAGGGAAGG + Intergenic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
983917051 4:173303271-173303293 TAGTAAGCACAGATAAGGGATGG + Intronic
984823439 4:183904666-183904688 CAGTGGCCACAGGTTATAGAGGG + Intronic
986199100 5:5565333-5565355 GAGGAGGCACAGAGTAGGGAGGG - Intergenic
988853496 5:35202495-35202517 AAGTAGGCAGAGAGTAGGGAGGG - Intronic
988873729 5:35420162-35420184 TATTAGCCACAGAGGAGGGATGG + Intergenic
991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG + Intergenic
994578576 5:101611240-101611262 CAGGAGCCACAGACTAGAGCAGG - Intergenic
994956565 5:106540712-106540734 CAGAAGCCTTAGATCAGGGAAGG - Intergenic
996021182 5:118592407-118592429 CACTACACACACATTAGGGAAGG - Intergenic
997012885 5:129900093-129900115 CAGTAGCTACAGCTCAGAGAAGG + Intergenic
997209462 5:132068948-132068970 TAGTAGACACAGGTCAGGGAGGG + Intergenic
1001082408 5:168676980-168677002 CAGAAGCCACAGATCAGAGAGGG + Intronic
1002564194 5:180100716-180100738 CTGTAGCCACAGTTCAGGCATGG - Intergenic
1002740358 5:181430937-181430959 CAGCAGGCCCAGATGAGGGAAGG - Intergenic
1004336900 6:14772105-14772127 CAAGAGCCACAGACTCGGGAAGG - Intergenic
1006659351 6:35626643-35626665 AAGTTGCCAAAGATTAGGGAAGG - Intronic
1008792205 6:55249949-55249971 CAGTAACAAAAAATTAGGGAGGG + Intronic
1008805101 6:55417347-55417369 AAGAAGCCACAGCTGAGGGAGGG - Intergenic
1011626029 6:89284609-89284631 CAGGAGCCACAGAATGTGGACGG + Intronic
1011826310 6:91309483-91309505 CACTAGTCAAAGATTAGAGAAGG + Intergenic
1014746162 6:125203332-125203354 CAGCAGCCACAAATTTGGGAAGG - Intronic
1015339867 6:132085958-132085980 CAGCAGCCACAGATAAGCCACGG + Intergenic
1019245469 6:170706541-170706563 CAGCAGGCCCAGATGAGGGAAGG - Intergenic
1020026514 7:4903677-4903699 CAGTAGACTCACATTTGGGAGGG - Intergenic
1021680840 7:23129595-23129617 CAATACCCACAGTTTGGGGACGG - Intronic
1023877018 7:44292067-44292089 CAGAAGGCAGAGATTAGGGCTGG + Intronic
1026254244 7:68697026-68697048 CAATAGGCAGAGAGTAGGGATGG + Intergenic
1027414649 7:77962256-77962278 CAGTGGCCAGAGAATAGAGAAGG - Intergenic
1029919043 7:104242859-104242881 CAGTGGCCACAGAGGAGAGAAGG + Intergenic
1032185933 7:129726164-129726186 CAGTAGGCACAGAATAGAGATGG - Intronic
1034676923 7:152898598-152898620 CTGTAGCCAGAGAGTGGGGATGG + Intergenic
1035502656 8:101664-101686 CAGCAGGCCCAGATGAGGGAAGG + Intergenic
1036012830 8:4747017-4747039 GAGAAGCCACTGAGTAGGGAGGG + Intronic
1036699160 8:11000388-11000410 CAGTAGACACATATTAGGCCAGG + Intronic
1038885619 8:31659533-31659555 CAGGAGCAACAGATTGGGGTAGG + Intronic
1041328761 8:56699325-56699347 AAATAGCCACAGAGTAGGTATGG - Intergenic
1041963096 8:63642586-63642608 CAGTCGCCAGAGATGAAGGAGGG - Intergenic
1042036305 8:64538201-64538223 CAGTAGCCACTGGTCAGAGAGGG - Intergenic
1042639508 8:70918236-70918258 AAGTATCCAGAGATTAGGGGAGG + Intergenic
1043910850 8:85862107-85862129 CAGTTACCAGAGATTGGGGAGGG - Intergenic
1044190166 8:89306560-89306582 CTGTAGACACTGATTTGGGAGGG - Intergenic
1045686482 8:104717979-104718001 CAGGAGCCAGAGATCAGTGAAGG - Intronic
1046747605 8:117892924-117892946 CAGAAGCAACATATTGGGGAGGG + Intronic
1056036769 9:82614950-82614972 CACGAGGAACAGATTAGGGAAGG - Intergenic
1057261526 9:93587376-93587398 GAGGAGCCTCAGATGAGGGACGG + Intronic
1058612168 9:106789001-106789023 CGCTAGTCACAGACTAGGGAAGG + Intergenic
1058845382 9:108952720-108952742 CAGAGGCCACAGAGCAGGGAAGG - Intronic
1058853867 9:109040498-109040520 CAGAGGCCAGAGTTTAGGGAGGG - Intronic
1062152198 9:135027013-135027035 CAGTGGCCCCAGATCAGGGCAGG - Intergenic
1203605667 Un_KI270748v1:55745-55767 CAGCAGGCCCAGATGAGGGAAGG - Intergenic
1192153648 X:68727182-68727204 GAGTAGGCAGAGATGAGGGATGG - Intergenic
1192901715 X:75505998-75506020 CACTAGGCAAAGATGAGGGAAGG + Intronic
1195574938 X:106439023-106439045 CAGATTCCACAGATTGGGGAGGG - Intergenic
1197962248 X:132019977-132019999 CATTATACACAGATTAGGTAAGG - Intergenic
1201234371 Y:11895364-11895386 CACTGGCAACAGAGTAGGGAGGG + Intergenic
1202387845 Y:24342183-24342205 CAGCAGGCCCAGATGAGGGAAGG - Intergenic
1202482942 Y:25327945-25327967 CAGCAGGCCCAGATGAGGGAAGG + Intergenic