ID: 1095252047

View in Genome Browser
Species Human (GRCh38)
Location 12:39990476-39990498
Sequence AAGAAGGATGTGCCCACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095252045_1095252047 22 Left 1095252045 12:39990431-39990453 CCTCTGAGTAAGAGTTCTTCTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1095252047 12:39990476-39990498 AAGAAGGATGTGCCCACACTTGG 0: 1
1: 0
2: 0
3: 17
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095252047 Original CRISPR AAGAAGGATGTGCCCACACT TGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
901341026 1:8499502-8499524 ATGGAGGATGTACACACACTGGG - Intronic
903765371 1:25730769-25730791 GAGGAGGAAGTGCCCACACAGGG - Intronic
904333896 1:29784813-29784835 AAGACGGCTGTGTCCTCACTGGG + Intergenic
906193030 1:43910914-43910936 AAGAGGGATGTGCCCACCCCAGG + Intronic
910024361 1:82631154-82631176 AAGAAGGGTGTCCCCACTCCAGG + Intergenic
911357912 1:96844276-96844298 CAGAAGGCTGTGTCCACACTAGG + Intergenic
913203703 1:116516851-116516873 AAGAAGCTTGTGGCCACACCAGG - Intronic
914390629 1:147219010-147219032 AAGAAGGATATGGCTACTCTCGG - Intronic
916827286 1:168454480-168454502 AAGGAGGATGTTCACAAACTGGG - Intergenic
917877917 1:179303771-179303793 AAGGAGGATGAGCCAATACTGGG + Intronic
921779016 1:219139160-219139182 AAGAAGGATGTGCCAACTCAAGG - Intergenic
1065751104 10:28888169-28888191 AAGAGGGACTTGCCCTCACTGGG - Intergenic
1066025861 10:31360240-31360262 AAGAAGGATGAGCTTAGACTTGG + Intronic
1067105119 10:43361441-43361463 TAGAAGGATGGGCTCTCACTGGG + Intergenic
1068556759 10:58466996-58467018 AGGAAGGCTGTGCTGACACTTGG + Intergenic
1070161753 10:73871082-73871104 AAGATGGATATGCCAAGACTGGG - Intronic
1072767783 10:98109718-98109740 AAGAGGGATGTAGACACACTGGG - Intergenic
1076570118 10:131426937-131426959 GAGGAGGAGGTGCCCACTCTGGG - Intergenic
1078096199 11:8298780-8298802 AAGAAGCATATCCCCACACCGGG + Intergenic
1079421415 11:20293020-20293042 TAGAAGGAAGTGCCCAAAATTGG + Intergenic
1080240168 11:30118594-30118616 AAGAAGAATGTGAACACACAGGG - Intergenic
1080760859 11:35247653-35247675 TGGAAGGAGGTGCCCACACTAGG + Intergenic
1082730045 11:56785040-56785062 AAGAAGAGTGTCCCAACACTAGG + Intergenic
1084535977 11:69757322-69757344 CAGAAGTATGTGCCCGCCCTGGG + Intergenic
1088403908 11:109450811-109450833 AAGCAGGATGTGCGGTCACTTGG - Intergenic
1092009964 12:5101512-5101534 AACAAGGATATCCTCACACTAGG - Intergenic
1095252047 12:39990476-39990498 AAGAAGGATGTGCCCACACTTGG + Intronic
1096250357 12:50027987-50028009 AAGTAGGATGAGACCACACTAGG + Intronic
1097572963 12:61356345-61356367 AAGCTGGGTGTGCACACACTCGG - Intergenic
1100669607 12:96796021-96796043 GAGAAGGATGTGACCTTACTTGG - Intronic
1100894946 12:99170994-99171016 AAGAAGGCTATGCCCACATTGGG + Intronic
1101075613 12:101126787-101126809 AAGAAGGATGTGGACCCTCTGGG - Intronic
1103536109 12:121634823-121634845 AGGCTGTATGTGCCCACACTTGG - Intronic
1104683957 12:130772281-130772303 AAGAAGCATGTGCCAACAACTGG + Intergenic
1105843623 13:24276329-24276351 AAGAAGGAAGTTCTAACACTTGG + Intronic
1107015421 13:35705085-35705107 TAGAAGGAGGTGCACACACTTGG + Intergenic
1108454545 13:50599671-50599693 CAGGAGGATGAGCCCAGACTGGG - Intronic
1119592906 14:75906815-75906837 TAGAAGGATGCTCCCAAACTGGG + Intronic
1120766485 14:88331767-88331789 AGGAAGGATGTGCCAATACCAGG + Intergenic
1121258648 14:92550131-92550153 AAGATGGAAGTGCCCAGAGTGGG - Intronic
1121960879 14:98258337-98258359 AAGAATGCTGTGCCCTCACTTGG + Intergenic
1122548422 14:102537564-102537586 GGGAAGGATGTGCACACACCAGG - Intergenic
1123687995 15:22813251-22813273 AAGAAGCCTGCGCACACACTGGG - Intronic
1125747722 15:42008503-42008525 AAGAAGTATGTGGCCACAGAGGG - Intronic
1128291716 15:66483200-66483222 AATGAGGATGTGTTCACACTGGG - Intronic
1129464447 15:75716093-75716115 AAGAAGGATGTTCCCACCCAGGG + Intergenic
1129720799 15:77876919-77876941 AAGAAGGATGTTCCCACCCAGGG - Intergenic
1131298340 15:91172323-91172345 GAGAGGGAAGTGTCCACACTGGG - Intronic
1134803166 16:17104183-17104205 AAGATGGCTGTGTCAACACTTGG + Exonic
1137966125 16:52935630-52935652 AGGCAGGATGGGCCCTCACTGGG - Intergenic
1138286655 16:55815531-55815553 AACAAGGTTGTGCCCACACAGGG - Intronic
1142286733 16:89174531-89174553 AAGAAAGCTCTGCACACACTGGG - Intronic
1144394943 17:14834920-14834942 AAAACGGATGTGTCCACAATTGG - Intergenic
1145315272 17:21727203-21727225 ACGAAGGATCTGCCCCCATTAGG - Intergenic
1145713704 17:26999141-26999163 AAGAAGGATCTGCCCCCTTTAGG - Intergenic
1147914511 17:43878563-43878585 AAGGAGGAGGTGCCCAGAATGGG + Intronic
1149204770 17:54230611-54230633 AAGAAGGATGGTCCCAGACATGG + Intergenic
1151231913 17:72690973-72690995 AGGGAGGAAGTGGCCACACTGGG + Intronic
1151620051 17:75239921-75239943 AACAAGGAGGAGCCCGCACTGGG + Exonic
1152467246 17:80473282-80473304 GAGAAGGGCGTGCCCACACCTGG + Exonic
1153303035 18:3608331-3608353 AAAAAAGATGAGCTCACACTGGG + Intronic
1154208703 18:12360527-12360549 AAGAAGCAGGTGCCATCACTGGG + Intronic
1156198711 18:34806067-34806089 AAAATGGATGTGCCCACATAAGG + Intronic
1156382855 18:36579656-36579678 AGGAAGGTTGTGCCCTCACATGG - Intronic
1158873021 18:61707224-61707246 AGGAAGAATGTGTCCACCCTAGG - Intergenic
1159976169 18:74714853-74714875 AAATAGGATGTGCCCAAAGTTGG + Intronic
1160113417 18:76055258-76055280 AATCCGCATGTGCCCACACTTGG - Intergenic
1160322341 18:77907880-77907902 AGGAGAGCTGTGCCCACACTGGG + Intergenic
1161149440 19:2699988-2700010 AAGAAGACTTTGCCCACACCTGG - Intronic
1164705734 19:30318072-30318094 AGGCCGGATGTGCCGACACTTGG - Intronic
1165700156 19:37931411-37931433 AAGAAGCAGGTGCTCCCACTGGG - Intronic
1166518604 19:43464658-43464680 CGGAAGGATGTGCCCACAGTTGG - Intronic
925636002 2:5941914-5941936 AAGAATGCTGAGCCCAGACTGGG - Intergenic
925732311 2:6928100-6928122 AAGAAGGACGTGCCCAAACAGGG - Intronic
927486184 2:23489832-23489854 AAGGAGGAGGTGCCCACATCAGG + Intronic
927939070 2:27092504-27092526 AAGAAGGATGTATCCACCCTGGG + Intronic
930882703 2:56290079-56290101 TAGAAGGATGTGGCCAGAATAGG - Intronic
931534986 2:63265146-63265168 AAGAAGAATAAGCCCAAACTTGG + Intronic
935718763 2:105961099-105961121 AACATGGATGTGCACCCACTAGG - Intergenic
935806179 2:106749970-106749992 GAGTTGGATGTGGCCACACTGGG + Intergenic
936167797 2:110138857-110138879 AGGAAAGGAGTGCCCACACTGGG - Intronic
940781773 2:157940919-157940941 AAGAAGGATGTGCTAACTCTTGG - Intronic
940962825 2:159804047-159804069 AAAAATAATGTTCCCACACTTGG + Exonic
943180289 2:184531241-184531263 CAGAGGGATGTGTGCACACTCGG - Intergenic
943345721 2:186734854-186734876 CAGCTGGATGTGCACACACTTGG - Intronic
945187739 2:207156717-207156739 AAGAAGGATGAAACAACACTTGG + Intronic
947122996 2:226836355-226836377 GGGAACGACGTGCCCACACTCGG + Intronic
947969134 2:234307267-234307289 GAGAAGGACATGCCCAGACTAGG + Intergenic
948605604 2:239132600-239132622 AAGAGGGATGAGCGCACACAGGG + Intronic
948749262 2:240121251-240121273 TAAAAGGATCTGACCACACTGGG - Intergenic
1171099825 20:22372615-22372637 CAGTAGGATGTGCCCAGACATGG - Intergenic
1171982476 20:31637816-31637838 AAGCAGGACGTTCCCACGCTGGG + Intergenic
1173732451 20:45338224-45338246 AAGCAGGAAGTAGCCACACTGGG + Intronic
1174157826 20:48528223-48528245 AAGTAGGAGGTGCCCACGGTGGG - Intergenic
1174870344 20:54175171-54175193 GGGAAGGATTTGCCAACACTTGG - Intergenic
1175070015 20:56325254-56325276 AAAAAGGATGTACCCACCCAGGG + Intergenic
1175304432 20:57966219-57966241 AAGAATGATCTGCCCAGAGTGGG + Intergenic
1177167725 21:17621680-17621702 AGGAAGGATGTGTCCTCACATGG - Intergenic
1177957870 21:27623337-27623359 GAGAAGGAAGTGCAAACACTCGG + Intergenic
1179230908 21:39502948-39502970 AAGACGGAGGTGGCCAGACTGGG - Intronic
1181053346 22:20247872-20247894 CTGAAGGCTCTGCCCACACTGGG - Intronic
1181943105 22:26494199-26494221 CAGATGGATGTGCCAGCACTTGG + Exonic
1184888098 22:47359437-47359459 AAGAAGGCTGAGCCCTCACAGGG - Intergenic
1185081868 22:48713969-48713991 AAGAAGGAGGTGTCAACACCGGG + Intronic
949701273 3:6761911-6761933 GGGAAGGATGTGCTCAGACTTGG + Intergenic
952646302 3:35663375-35663397 AAGAACTATGCGCCCAGACTGGG - Intronic
956736938 3:72245349-72245371 AAGAAGCACGTGCACTCACTGGG + Intergenic
957875014 3:86133406-86133428 AGGAAGTATGTCCACACACTGGG + Intergenic
957963635 3:87293426-87293448 AAGAAGGTTCAGTCCACACTCGG - Intergenic
960155434 3:114293226-114293248 AAGAAGGATGGGTCCATAGTAGG + Intronic
962601838 3:136997067-136997089 AAAACAGATATGCCCACACTCGG - Intronic
967240461 3:187434152-187434174 AAGAAAGTTGTGCTTACACTAGG - Intergenic
967947225 3:194813632-194813654 CAGAAAGCTGGGCCCACACTTGG + Intergenic
970787449 4:19816118-19816140 AAGAAGGCGGAACCCACACTAGG + Intergenic
970965532 4:21923700-21923722 GAGAAGGATGAGCCCACGGTGGG - Intronic
978075080 4:104518639-104518661 ATGAAGGATGAGCCAAAACTTGG + Intergenic
979027326 4:115594120-115594142 AAGAATAATGTACCCACACCAGG - Intergenic
985263790 4:188139644-188139666 ACAAAAGCTGTGCCCACACTCGG - Exonic
993124134 5:83811374-83811396 AAGAAGCATTCGCCTACACTTGG + Intergenic
995849907 5:116534065-116534087 ATGTAGGTTGTGCCCACCCTTGG - Intronic
997831819 5:137157002-137157024 TAGAAAGATATGGCCACACTTGG + Intronic
999262349 5:150245696-150245718 AAGAAGCAGATGCCCCCACTGGG + Intronic
1000390932 5:160722672-160722694 AAGAAGCATCTGCCATCACTGGG + Intronic
1002613195 5:180434861-180434883 ATGTAGGATGAGCCCAGACTAGG + Intergenic
1003736017 6:8878455-8878477 AAGGAGGAAGTCCCCACAGTGGG + Intergenic
1004882884 6:20026013-20026035 AGGAGGGATTTGACCACACTAGG - Intergenic
1005946678 6:30600976-30600998 AAGAATGGTGAGCCCACGCTGGG + Exonic
1006626745 6:35403060-35403082 AAGAAGCATGTGCCCAGAGTAGG + Intronic
1019030763 6:169008903-169008925 ATGAAGGATTAGCCCACTCTTGG + Intergenic
1019401896 7:859550-859572 GAGAAGGGTGTGTCCACACGTGG + Intronic
1020349471 7:7202078-7202100 GAGAAGGATGTGACCTCACCTGG - Intronic
1020932836 7:14421009-14421031 ATGAAGGATTGGCCCACGCTTGG - Intronic
1022536858 7:31103665-31103687 AGGCAGGATGTGGACACACTGGG - Intronic
1027932416 7:84554366-84554388 AAGAAGGATTGGGTCACACTTGG + Intergenic
1028363967 7:90005451-90005473 AAGAAGGCTGTGTCCTCACCTGG - Intergenic
1037062093 8:14526739-14526761 AAGAATGAAGTACGCACACTAGG - Intronic
1038090765 8:24250507-24250529 AAGCAGGATGTTCTCACACCTGG + Intergenic
1041331215 8:56727479-56727501 GAGAGGGATATGCGCACACTTGG + Intergenic
1043376661 8:79657167-79657189 AAGAAGGATATGCCCTGGCTGGG - Intronic
1044630094 8:94270257-94270279 AAGAAAGATGTGCACACATAGGG + Intergenic
1048247782 8:132827569-132827591 AATAAGAAGGGGCCCACACTTGG + Intronic
1052159495 9:25239072-25239094 AAGATGAATGTGCCACCACTGGG + Intergenic
1055823333 9:80294593-80294615 AATAAGGATGTGAACAAACTAGG - Intergenic
1057421247 9:94914605-94914627 TTGAAAGATGTGGCCACACTAGG - Intronic
1058814500 9:108670855-108670877 AAGAGGAATGTGCCCAACCTGGG - Intergenic
1059992166 9:119875580-119875602 AAAAAGAATGTGCCTGCACTGGG - Intergenic
1062205983 9:135337674-135337696 CAGCAGGATGTGCCCGCCCTGGG + Intergenic
1186217421 X:7314833-7314855 GAGAAGGATGTGGCCACGGTGGG + Intronic
1187333391 X:18361114-18361136 AAAAAGGATGATACCACACTTGG - Intergenic
1192055177 X:67766530-67766552 AAGAAGTATGTTCCCACCTTGGG + Intergenic
1195632165 X:107069023-107069045 AAGAAGGAAGTACCAAGACTGGG + Intronic
1197773354 X:130104820-130104842 AGGCAGGAAGTGCCCACACTGGG + Intronic