ID: 1095254433

View in Genome Browser
Species Human (GRCh38)
Location 12:40017933-40017955
Sequence TTCAGTGTGGTAATTCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3583
Summary {0: 1, 1: 0, 2: 1, 3: 90, 4: 3491}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095254433 Original CRISPR TTCAGTGTGGTAATTCCTAG TGG (reversed) Intronic
Too many off-targets to display for this crispr