ID: 1095254902

View in Genome Browser
Species Human (GRCh38)
Location 12:40023218-40023240
Sequence TTGTGCTAAGGCAGGATCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095254902 Original CRISPR TTGTGCTAAGGCAGGATCAT TGG (reversed) Intronic
900888324 1:5430958-5430980 ATGCCCTAAGACAGGATCATCGG - Intergenic
902569308 1:17336663-17336685 TTGTGGAAAGACAGGATGATGGG + Intronic
903739617 1:25551107-25551129 TTGTGCTGAGAAAGGATCAGAGG + Intronic
905187402 1:36206466-36206488 TGGTGCTGAGGCAGGAGAATAGG + Intergenic
908376961 1:63553204-63553226 TGGAGATAAGGAAGGATCATGGG + Intronic
911502449 1:98705021-98705043 TTGTTCAAATGCAGGATTATAGG - Intronic
915519653 1:156434521-156434543 TTGTGGTGAGGCTGGATTATGGG - Intergenic
918387811 1:184028100-184028122 TGGTGCTGAGACAGGATTATGGG + Intronic
919545273 1:198909682-198909704 TTGTGCTAATCCTTGATCATAGG - Intergenic
920602913 1:207347193-207347215 TTTTCCTAAGACAGTATCATGGG - Intronic
923893572 1:238242745-238242767 TTGTTCCAAGGCAGGGTCAGAGG - Intergenic
1068938980 10:62662430-62662452 TTGTTCTGAGGCAGGAGAATAGG - Intronic
1070436669 10:76400577-76400599 TTGTGCTCAGGAAGGAGAATTGG - Intronic
1071439340 10:85676613-85676635 TAGGGCTAGGGCAGGCTCATTGG - Intronic
1073695201 10:105858834-105858856 TTGTGCTAAGTCAGACTCCTGGG + Intergenic
1074826306 10:117217509-117217531 TGGTGACAAGGCAGGACCATAGG - Intergenic
1077657191 11:4030854-4030876 TTGAGCTAAGGTAGTATCATCGG - Intronic
1080391665 11:31853592-31853614 TTGTGTGAAGGCAGTTTCATTGG + Intronic
1085826237 11:79850868-79850890 TTGTGCTAAGTAAGGATGCTTGG - Intergenic
1089702676 11:120254909-120254931 TTGTGCCAAGCCAGGAGCATGGG + Intronic
1090356083 11:126141194-126141216 TTGTGCTAAGCAAGGATGAATGG + Intergenic
1091201575 11:133784677-133784699 TTGAGCTAGGGCAGGCTCTTTGG - Intergenic
1091395412 12:151457-151479 TTGGGCTAAGGCAGGAGCAGTGG - Intronic
1092486610 12:8907766-8907788 TTGTGCTGAGGCAGGAAAATAGG - Intergenic
1094121110 12:26975323-26975345 TTATGATAACTCAGGATCATGGG - Intronic
1095254902 12:40023218-40023240 TTGTGCTAAGGCAGGATCATTGG - Intronic
1095254907 12:40023259-40023281 GCGTGCTAAGGCAGGATCATTGG - Intronic
1096149323 12:49298581-49298603 TTGTCCTGAGGGGGGATCATTGG - Exonic
1099389045 12:82055775-82055797 TTATGCTAAGCCAAGATTATAGG - Intergenic
1105695024 13:22879610-22879632 TTGTGCTAAGGCAGAATGATAGG - Intergenic
1105866240 13:24461932-24461954 TTGTACTAGTGCAGGATCCTGGG - Intronic
1106655009 13:31734115-31734137 TTGTGGTATGGCATGGTCATTGG - Intergenic
1107386909 13:39920351-39920373 TTTTGCTAAGGGAGGATCCAAGG - Intergenic
1110146946 13:72203158-72203180 TTGTGCTAATGCAGGGTCGGGGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1113225275 13:108152791-108152813 TTTTGCAAAGGCAGGTTCATTGG - Intergenic
1115659752 14:35481298-35481320 TTGGGATAAGGCAAGAGCATAGG + Intergenic
1116207622 14:41888376-41888398 TTGAGCAATGGCAGCATCATTGG - Intronic
1117184729 14:53228177-53228199 TTGTTCTAAGGCATGAAAATTGG + Intergenic
1118387565 14:65269022-65269044 TTGTGCTAAGGCTGGAATGTAGG + Intergenic
1125157359 15:36603011-36603033 TTGAGCCATGGCAGCATCATTGG + Intronic
1134174802 16:11996995-11997017 TGGGGGTAAGGCAGGATCCTTGG + Intronic
1135703389 16:24653069-24653091 TTTTTCTAAGACAGGATTATGGG + Intergenic
1138212975 16:55178708-55178730 CTGTGATAAGCCAGGAACATCGG - Intergenic
1145305432 17:21671712-21671734 TTGAGCCAAGGCAGGATGGTGGG - Intergenic
1152995476 18:402421-402443 TGGTGCTGAGGCAGGAGAATAGG - Intronic
1153345430 18:4020544-4020566 TTTTGCTAAGGCAGTTTCACAGG - Intronic
1154409658 18:14131171-14131193 TTGTGCTAAGGGAGGATACAAGG + Intronic
927219786 2:20696294-20696316 TTGGGCTAAGGCAGGCTAAGAGG + Intronic
927861063 2:26560441-26560463 CTTGGCTAGGGCAGGATCATGGG - Intergenic
930399454 2:50864610-50864632 TTGTGATATGGCAGTATTATGGG - Intronic
930466794 2:51763369-51763391 TTGTGCTTAGGCCGAAACATTGG - Intergenic
932876455 2:75457229-75457251 TTGTACTAAGGTAGGAGAATTGG + Intergenic
935098245 2:99967816-99967838 TTGGGCTAAGGCAGTGGCATTGG - Intronic
936350867 2:111711576-111711598 TTTTGCAAAGGCAGTTTCATTGG - Intergenic
941434461 2:165452185-165452207 CTGTGCTAAGTCAAGATCAGTGG - Intergenic
941642910 2:168008304-168008326 GTGAGCAAAGGCAGGATCCTGGG + Intronic
946130024 2:217599551-217599573 TGATGCTAAGTCAGGATCAGAGG - Intronic
1174185808 20:48705154-48705176 ATCTGCGAAGTCAGGATCATGGG - Intronic
1175410042 20:58761740-58761762 ACGTGCTTAGGCAGGATCTTAGG + Intergenic
1176863569 21:14028681-14028703 TTGTGCTAAGGGAGGATACAAGG - Intergenic
1181537886 22:23556127-23556149 TGGTGCCAAGGCAGGATGGTTGG + Intergenic
1184359372 22:44005538-44005560 TGGTGCTGAGGCAGGAGAATGGG + Intronic
949110335 3:253261-253283 TGGTGCTAAGGGAGCATAATTGG - Intronic
949580968 3:5387759-5387781 TTGTGCAAAGTCAGGTTTATAGG - Intergenic
950243138 3:11389700-11389722 TTGAGTAAAGGCAGCATCATTGG + Intronic
959245605 3:103863449-103863471 TTTTGCTCTTGCAGGATCATAGG + Intergenic
960402491 3:117218990-117219012 TTGAGCTCAGTCAGGATTATAGG + Intergenic
963908309 3:150792473-150792495 TTGTGAGAAGGCAAGATCAGGGG - Intergenic
968928519 4:3562786-3562808 TTTTGCAAAGGCAGTTTCATGGG - Intergenic
971362418 4:25950400-25950422 TTGTGCTTGGAGAGGATCATTGG - Intergenic
975564731 4:75742310-75742332 TTGTGCTAAGGCTAGGACATCGG + Intronic
976119851 4:81768013-81768035 TTGTGCTAAGGAATTATCAGAGG + Intronic
980029504 4:127810704-127810726 TAGTGCAGTGGCAGGATCATAGG - Intronic
984288384 4:177762438-177762460 TTGTGCTAAGAAAGGAGCCTTGG + Intronic
986255579 5:6100384-6100406 ATGTGATAAGGGAGGTTCATGGG - Intergenic
987221496 5:15794772-15794794 TTGTTGTAAGGCAGGAACAGAGG - Intronic
991314989 5:65291922-65291944 TTGTGTTAAGGCATGTCCATAGG + Intronic
997254512 5:132418071-132418093 CTGTGCACAGGCTGGATCATGGG - Intronic
997816595 5:137025279-137025301 TTGTGCTCTGGCAGCATCACAGG - Intronic
999284575 5:150386571-150386593 GTGTGCTAAGTCAGGCTCAGGGG + Intronic
1008258452 6:49334246-49334268 TTATACTAAGACAGGAACATTGG + Intergenic
1012607689 6:101178152-101178174 TTGTGCTAAGGGGTCATCATGGG + Intergenic
1013472122 6:110475311-110475333 TTGTGCTTAGGCAGAAACCTTGG + Intronic
1025283380 7:57644109-57644131 TTGAGCCAAGGCAGGATGGTGGG - Intergenic
1031141117 7:117944773-117944795 TAGTGCTATGGCAGGCTCAGTGG + Intergenic
1035896881 8:3412941-3412963 TTGTGCTATGCCAGGACCCTGGG - Intronic
1043499918 8:80842734-80842756 TTGAGCTAAGGAAGTATAATAGG - Intronic
1043920700 8:85980203-85980225 TTGTGATAACTCATGATCATGGG - Intergenic
1046207472 8:111020282-111020304 TTGTTCTAAGACAGGCTCAGAGG - Intergenic
1046674397 8:117092782-117092804 TTTTGCTCAGGCAGCATCCTTGG - Intronic
1047315973 8:123733272-123733294 TTCTGCTAGGGCTTGATCATGGG + Intronic
1047503420 8:125460035-125460057 CTGTGCTAAGGGAAGATGATGGG - Intergenic
1050685902 9:8169113-8169135 TTTTGCAAAGGCAGGATTAAAGG - Intergenic
1051680441 9:19602234-19602256 TTGTGCTATGCCTGGAACATTGG + Intronic
1053070835 9:35101060-35101082 TGGTGCTGGGGCAGGATCTTTGG - Intronic
1053803401 9:41777928-41777950 TTTTGCAAAGGCAGTTTCATGGG - Intergenic
1054141862 9:61537196-61537218 TTTTGCAAAGGCAGTTTCATGGG + Intergenic
1054191693 9:61989238-61989260 TTTTGCAAAGGCAGTTTCATGGG - Intergenic
1054461620 9:65468374-65468396 TTTTGCAAAGGCAGTTTCATGGG + Intergenic
1054646677 9:67598474-67598496 TTTTGCAAAGGCAGTTTCATGGG + Intergenic
1061327560 9:129873597-129873619 TTCTGGGAAGGCAGGATTATAGG - Intronic
1187239901 X:17502834-17502856 TTGTTCTAAAGCAGAAGCATCGG - Intronic
1195727563 X:107934115-107934137 TTGTGCTCTGGAAGGATCACAGG + Intergenic
1195996192 X:110733802-110733824 GGAGGCTAAGGCAGGATCATTGG + Intronic
1196622081 X:117835333-117835355 ATGGGCTAAGGCAGGAGCAGCGG + Intergenic
1198245271 X:134824989-134825011 ATGTGCCAATGCAGGTTCATTGG + Intronic
1198601941 X:138293768-138293790 AAGTGCTAAGGCAGGATCTGTGG - Intergenic
1200376295 X:155784014-155784036 TTTAGCAAAGGTAGGATCATTGG - Intergenic
1201384865 Y:13428801-13428823 TTCTTCTAATGCAGGATCATGGG + Intronic