ID: 1095259214

View in Genome Browser
Species Human (GRCh38)
Location 12:40079665-40079687
Sequence CAGTGTTAGATCATCGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 1, 2: 7, 3: 8, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095259214_1095259216 15 Left 1095259214 12:40079665-40079687 CCTGCCTCGATGATCTAACACTG 0: 1
1: 1
2: 7
3: 8
4: 66
Right 1095259216 12:40079703-40079725 AGTCTCCCATTATTATTGTGTGG 0: 3585
1: 5527
2: 2752
3: 1484
4: 1003

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095259214 Original CRISPR CAGTGTTAGATCATCGAGGC AGG (reversed) Intronic
903048675 1:20584577-20584599 TAGTGTGAGATCCTCAAGGCAGG + Intergenic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
905453859 1:38074252-38074274 CAGGGTTAGAGCAGCCAGGCAGG - Intergenic
907792981 1:57685487-57685509 CAGTGTTAGATCAACAAGGTAGG + Intronic
909110083 1:71464196-71464218 CAGTGTTGTATCATCAAGTCAGG + Intronic
911404143 1:97415303-97415325 AAGTGTTATTTCATTGAGGCTGG - Intronic
918535700 1:185572217-185572239 CATTGTTAAAACATTGAGGCAGG + Intergenic
919733551 1:200929956-200929978 CAGTGTTAGATCCTGGAGGCTGG - Intergenic
920240166 1:204541160-204541182 CACTGTTAGAAAATCAAGGCTGG + Intronic
1069654323 10:70076731-70076753 CAGTGTTAGACCATCTGGGGAGG - Intronic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1070651120 10:78237133-78237155 CAGTGTTCAAGCATCAAGGCTGG - Intergenic
1071278764 10:84080293-84080315 AAATGTTAAATCATCTAGGCTGG + Intergenic
1072831856 10:98666357-98666379 CAGTGTTAGATCATTGAGGCAGG + Intronic
1073886951 10:108050318-108050340 CAGTGTGAGCTCATCAAGGAAGG + Intergenic
1074827343 10:117223943-117223965 CAGTGTTAGTTCCACGAGGCAGG + Intergenic
1075179974 10:120202133-120202155 TAGTATGAGATCATCAAGGCAGG - Intergenic
1079132430 11:17755153-17755175 CAGTGCAAGAGCATGGAGGCAGG + Intronic
1084132170 11:67144595-67144617 CTCTGTTAGCTCATCCAGGCTGG + Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1094392556 12:29967582-29967604 CAGTGTTATATCATCACTGCAGG + Intergenic
1095259214 12:40079665-40079687 CAGTGTTAGATCATCGAGGCAGG - Intronic
1105802298 13:23917583-23917605 CAGCATTAGATCATCAAGGCAGG + Intergenic
1106406587 13:29480060-29480082 CATGGTCAGATCATCAAGGCTGG - Intronic
1107297034 13:38920599-38920621 GAGTATTAGATCATCGAGGCAGG - Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1108573525 13:51771988-51772010 CAGTGTAAGATAAGCCAGGCTGG - Intronic
1123075838 14:105667058-105667080 CACTGTTGGGCCATCGAGGCCGG - Intergenic
1130398663 15:83529254-83529276 CAGTGTTAGCAGATCCAGGCAGG + Intronic
1133503942 16:6391812-6391834 CAGTGTGAGCTCTTCGAGGATGG - Intronic
1138873405 16:60920434-60920456 AGGTGATAGATCATGGAGGCAGG - Intergenic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1139501616 16:67371013-67371035 TGGTGTTAAATCATCCAGGCTGG - Exonic
1146020445 17:29273466-29273488 CAGTGTTAAAAGATCAAGGCTGG - Intronic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
1167940797 19:52944304-52944326 CAGTGTCAAACCACCGAGGCAGG + Intronic
1168073558 19:53965969-53965991 CAGTGTGAGGTCAGCGTGGCCGG + Intronic
1168359807 19:55729884-55729906 CAGGGAGGGATCATCGAGGCTGG + Exonic
929912244 2:46100063-46100085 CAGAGCTAGATCATCCAGTCTGG - Intronic
932036063 2:68248101-68248123 CAGTGTTAGTTTAGCGTGGCTGG - Intronic
933651714 2:84855071-84855093 CAGTGCCATATCATCGAGTCAGG - Intronic
936407488 2:112219831-112219853 CAGTATTAGATCGTTGAGGTAGG - Intronic
937911319 2:127077009-127077031 CAGTGTGAGATCAGCTAGGAGGG - Intronic
939482130 2:142762154-142762176 CAGTGTTAGTACATCCAGGTAGG - Intergenic
946829675 2:223715405-223715427 CAGTTTTAGATAATTGTGGCTGG - Intergenic
947808422 2:232983949-232983971 CAGTTTTACATCCTCCAGGCTGG + Intronic
1169976050 20:11329140-11329162 CAATGTTAGACCAAAGAGGCCGG + Intergenic
950948190 3:16972548-16972570 CAATGTTAGATCATCAAGGCAGG - Intronic
956650692 3:71501921-71501943 CAGAGTGAGATCAGCAAGGCAGG + Intronic
959879403 3:111425775-111425797 CAGTATTAGATCACTGAGGCAGG + Intronic
963615057 3:147526454-147526476 CAGTATTAGATCATTAAGGCAGG - Intergenic
963925584 3:150947481-150947503 CAGTATTAGATCATGGAGGCAGG + Intronic
965771347 3:172184645-172184667 CAGTGTGTGATCATCCAGGAGGG + Intronic
968134536 3:196211441-196211463 CAGTGTGACATCACAGAGGCTGG + Intergenic
968780898 4:2580537-2580559 AAGTGTTGGATCATGGAGGTGGG + Intronic
969470683 4:7385731-7385753 CAGTGTTATACCCCCGAGGCAGG - Intronic
973673877 4:53244165-53244187 CAGTATTAGATCATTGAGGCAGG + Intronic
977332663 4:95657267-95657289 CAGTATTAGATCATCAAGGCAGG - Intergenic
977817751 4:101434870-101434892 CAGTGTAAGAAAATTGAGGCTGG - Intronic
978318399 4:107465586-107465608 CAGTGTTAATTCATTGAGGATGG - Intergenic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
988087251 5:26487814-26487836 CAGTGGTAGAGTATGGAGGCTGG - Intergenic
988444224 5:31267275-31267297 CAGTGTTAGAGCAAATAGGCTGG - Intronic
994150688 5:96444342-96444364 AAGTGTCAGAACATCAAGGCAGG - Intergenic
997655685 5:135552707-135552729 CAGTGGCAGATAATGGAGGCAGG - Intergenic
998225069 5:140320634-140320656 CTGTGCTAGGCCATCGAGGCTGG + Intergenic
1002383838 5:178850807-178850829 CACTTTAAGATCATCCAGGCCGG - Intergenic
1003815427 6:9834998-9835020 CAGTGTTATAGCATCAAGGGTGG - Intronic
1008981522 6:57489258-57489280 AAGTGTTAGATTATTTAGGCCGG + Intronic
1009169615 6:60382287-60382309 AAGTGTTAGATTATTTAGGCCGG + Intergenic
1017253715 6:152309830-152309852 CAGTGTAACATCATGCAGGCAGG - Exonic
1020896816 7:13950759-13950781 CTGAGTTAGATCATCAGGGCTGG - Intronic
1029574159 7:101392047-101392069 CAGTGTGTGTTCTTCGAGGCAGG + Intronic
1032901925 7:136320358-136320380 CAGTGTTAGCAGATCCAGGCAGG + Intergenic
1047939284 8:129813273-129813295 CAGCATTAGATTATTGAGGCAGG - Intergenic
1047975643 8:130127579-130127601 CAGTGTGAGATGGTCCAGGCTGG + Intronic
1052700299 9:31930156-31930178 CAGTGTTATATTATAGAGGAAGG - Intergenic
1188632150 X:32376739-32376761 AAGTGTTAGATCATTGTGGAAGG + Intronic
1188757852 X:33986912-33986934 CAGTGTTAGTGGATCCAGGCAGG + Intergenic
1191949528 X:66573131-66573153 CAGTATTAGATCATTGAGGCAGG - Intergenic
1193442308 X:81557277-81557299 CAGTGTTAGCTAATCTAGGCAGG - Intergenic
1196514460 X:116553168-116553190 CAGTGTTAGTTTGTGGAGGCAGG - Intergenic
1196600142 X:117592050-117592072 CAATATTAGATCATTGAGACAGG + Intergenic