ID: 1095261715

View in Genome Browser
Species Human (GRCh38)
Location 12:40105829-40105851
Sequence CCGCGGAGCCGCGTCCCCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095261715_1095261720 -9 Left 1095261715 12:40105829-40105851 CCCGGGGGGACGCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1095261720 12:40105843-40105865 GCTCCGCGGGCCGGCAGTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 82
1095261715_1095261724 16 Left 1095261715 12:40105829-40105851 CCCGGGGGGACGCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1095261724 12:40105868-40105890 AGCTAGACAGCCCGAGCCGGCGG 0: 1
1: 0
2: 1
3: 7
4: 66
1095261715_1095261725 17 Left 1095261715 12:40105829-40105851 CCCGGGGGGACGCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1095261725 12:40105869-40105891 GCTAGACAGCCCGAGCCGGCGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1095261715_1095261723 13 Left 1095261715 12:40105829-40105851 CCCGGGGGGACGCGGCTCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1095261723 12:40105865-40105887 GCGAGCTAGACAGCCCGAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095261715 Original CRISPR CCGCGGAGCCGCGTCCCCCC GGG (reversed) Exonic